Incidental Mutation 'R5495:Vnn1'
ID432297
Institutional Source Beutler Lab
Gene Symbol Vnn1
Ensembl Gene ENSMUSG00000037440
Gene Namevanin 1
SynonymsV-1, pantetheinase
MMRRC Submission 043056-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R5495 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location23894688-23905343 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 23898564 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 168 (F168L)
Ref Sequence ENSEMBL: ENSMUSP00000040599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041416]
Predicted Effect probably damaging
Transcript: ENSMUST00000041416
AA Change: F168L

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000040599
Gene: ENSMUSG00000037440
AA Change: F168L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:CN_hydrolase 52 279 2.5e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219254
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vanin family of proteins, which share extensive sequence similarity with each other, and also with biotinidase. The family includes secreted and membrane-associated proteins, a few of which have been reported to participate in hematopoietic cell trafficking. No biotinidase activity has been demonstrated for any of the vanin proteins, however, they possess pantetheinase activity, which may play a role in oxidative-stress response. This protein, like its mouse homolog, is likely a GPI-anchored cell surface molecule. The mouse protein is expressed by the perivascular thymic stromal cells and regulates migration of T-cell progenitors to the thymus. This gene lies in close proximity to, and in the same transcriptional orientation as, two other vanin genes on chromosome 6q23-q24. [provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for disruptions of this gene develop normally and so no abnormalities in the maturation of lymphoid organs. However, membrane bound pantetheinase is absent in livers and kidneys resuulting in an absence of cysteamine in these organs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130204L05Rik A T 3: 91,090,295 L38M possibly damaging Het
Akt2 T C 7: 27,636,169 probably null Het
Arhgap29 T G 3: 122,014,929 M844R probably damaging Het
Atp1a1 T G 3: 101,591,425 D184A probably benign Het
Bcl11a T A 11: 24,165,042 V795E possibly damaging Het
Casp12 T A 9: 5,353,797 I277N possibly damaging Het
Ccdc59 A G 10: 105,845,378 K164E probably damaging Het
D630003M21Rik C T 2: 158,220,511 G30S possibly damaging Het
Dgkd A G 1: 87,926,872 D632G probably damaging Het
Efr3a A G 15: 65,815,409 K56E possibly damaging Het
Egflam T A 15: 7,251,241 R434S probably damaging Het
Fancl C G 11: 26,397,801 A51G probably damaging Het
Fkbp7 T C 2: 76,663,294 Y185C probably damaging Het
Galc A G 12: 98,231,414 probably null Het
Galnt15 A G 14: 32,029,817 S109G probably damaging Het
Gm13757 T C 2: 88,446,057 T294A probably benign Het
Gramd3 T C 18: 56,482,622 I163T probably damaging Het
Impa1 A G 3: 10,326,170 V80A probably benign Het
Itga10 T C 3: 96,647,371 M56T possibly damaging Het
Larp1b G T 3: 41,035,822 R135I probably damaging Het
Lgals12 C T 19: 7,604,130 A71T probably damaging Het
Lmbr1 A T 5: 29,346,853 L78* probably null Het
Lrat C A 3: 82,896,982 M229I probably benign Het
Mug2 A T 6: 122,079,650 M1185L probably damaging Het
Naprt T C 15: 75,893,847 probably null Het
Nfat5 A G 8: 107,368,447 I1107V probably benign Het
Nr4a2 T C 2: 57,112,375 Y22C probably damaging Het
Ogfod1 C A 8: 94,064,278 Q526K probably benign Het
Olfr139 G A 11: 74,044,785 T163I probably damaging Het
Olfr710 C A 7: 106,944,492 G170* probably null Het
Olfr957 T C 9: 39,511,145 T192A probably benign Het
Parp10 T G 15: 76,243,166 I24L probably benign Het
Pcdha11 A G 18: 37,011,026 T57A probably benign Het
Prdm8 A G 5: 98,185,306 E244G possibly damaging Het
Prl6a1 T C 13: 27,312,671 S3P possibly damaging Het
Rab11fip3 T A 17: 26,016,143 T18S probably damaging Het
Rfc4 T C 16: 23,122,254 probably benign Het
Rubcnl G T 14: 75,042,337 V387F possibly damaging Het
Serpinb12 T C 1: 106,956,421 L299P probably damaging Het
Sptbn5 G A 2: 120,046,484 probably benign Het
Taar4 A T 10: 23,961,283 I264F possibly damaging Het
Tdpoz4 A T 3: 93,797,499 T368S probably benign Het
Thsd7b T A 1: 129,595,833 H124Q probably damaging Het
Ugt1a6a A T 1: 88,139,024 Q184L probably benign Het
Zan A G 5: 137,470,408 L267P probably damaging Het
Zswim8 A G 14: 20,722,286 S1621G probably damaging Het
Other mutations in Vnn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Vnn1 APN 10 23900779 missense possibly damaging 0.51
IGL01299:Vnn1 APN 10 23895051 missense probably damaging 1.00
IGL01353:Vnn1 APN 10 23900840 missense probably damaging 1.00
IGL01774:Vnn1 APN 10 23900710 missense probably benign 0.26
IGL01970:Vnn1 APN 10 23897402 missense probably benign 0.06
IGL01985:Vnn1 APN 10 23900744 missense probably benign 0.00
IGL02019:Vnn1 APN 10 23903551 missense possibly damaging 0.69
IGL02198:Vnn1 APN 10 23903425 missense probably benign 0.00
IGL02349:Vnn1 APN 10 23898503 missense possibly damaging 0.91
IGL02738:Vnn1 APN 10 23904622 missense probably benign 0.00
IGL03058:Vnn1 APN 10 23904544 missense probably benign 0.06
R0008:Vnn1 UTSW 10 23898602 critical splice donor site probably null
R0030:Vnn1 UTSW 10 23900846 missense probably benign 0.08
R0508:Vnn1 UTSW 10 23895012 missense probably benign 0.01
R0781:Vnn1 UTSW 10 23899601 missense possibly damaging 0.46
R1110:Vnn1 UTSW 10 23899601 missense possibly damaging 0.46
R1757:Vnn1 UTSW 10 23900828 missense possibly damaging 0.49
R1757:Vnn1 UTSW 10 23900829 missense probably benign 0.00
R1778:Vnn1 UTSW 10 23899517 missense possibly damaging 0.67
R2011:Vnn1 UTSW 10 23894971 nonsense probably null
R2055:Vnn1 UTSW 10 23900577 splice site probably benign
R2158:Vnn1 UTSW 10 23900755 nonsense probably null
R2186:Vnn1 UTSW 10 23897401 missense probably benign 0.29
R4277:Vnn1 UTSW 10 23898512 missense possibly damaging 0.89
R4279:Vnn1 UTSW 10 23898512 missense possibly damaging 0.89
R4473:Vnn1 UTSW 10 23894891 missense probably benign
R4590:Vnn1 UTSW 10 23899405 missense possibly damaging 0.61
R4708:Vnn1 UTSW 10 23897352 missense probably benign 0.01
R4794:Vnn1 UTSW 10 23900704 missense probably benign 0.01
R5266:Vnn1 UTSW 10 23903405 missense probably damaging 1.00
R6064:Vnn1 UTSW 10 23894909 missense probably benign 0.05
R7081:Vnn1 UTSW 10 23895005 missense possibly damaging 0.66
R7088:Vnn1 UTSW 10 23900747 missense probably benign 0.00
R7221:Vnn1 UTSW 10 23895054 missense probably benign 0.07
R7334:Vnn1 UTSW 10 23900760 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CCACTATTGGCGTCCTTTGAAG -3'
(R):5'- AAATACTGCCCTCTCTGCTG -3'

Sequencing Primer
(F):5'- TCTCTCCCAATGGAAATATATACCAG -3'
(R):5'- TGCTGTCACCACTCCACTCTAAAG -3'
Posted On2016-10-05