Incidental Mutation 'R7463:Ptpn18'
ID578538
Institutional Source Beutler Lab
Gene Symbol Ptpn18
Ensembl Gene ENSMUSG00000026126
Gene Nameprotein tyrosine phosphatase, non-receptor type 18
SynonymsPTP-K1, FLP1, PTP-HSCF, HSCF, Ptpk1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.180) question?
Stock #R7463 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location34459762-34475733 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 34473364 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 417 (D417N)
Ref Sequence ENSEMBL: ENSMUSP00000027302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027302] [ENSMUST00000188972] [ENSMUST00000190122]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027302
AA Change: D417N

PolyPhen 2 Score 0.754 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000027302
Gene: ENSMUSG00000026126
AA Change: D417N

DomainStartEndE-ValueType
PTPc 25 293 7.77e-115 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000188972
AA Change: D68N

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000190122
SMART Domains Protein: ENSMUSP00000139885
Gene: ENSMUSG00000026126

DomainStartEndE-ValueType
PTPc 2 269 9.1e-113 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, the mitotic cycle, and oncogenic transformation. This PTP contains a PEST motif, which often serves as a protein-protein interaction domain, and may be related to protein intracellular half-live. This protein can differentially dephosphorylate autophosphorylated tyrosine kinases that are overexpressed in tumor tissues, and it appears to regulate HER2, a member of the epidermal growth factor receptor family of receptor tyrosine kinases. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,323,772 V435E probably damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adcy2 T C 13: 68,730,280 D413G probably damaging Het
Adgrg6 T A 10: 14,434,396 D727V possibly damaging Het
Aebp2 C T 6: 140,637,726 Q309* probably null Het
Amy1 A T 3: 113,569,884 C43* probably null Het
Bpifc T C 10: 85,979,334 E256G probably benign Het
Bysl A T 17: 47,602,471 S296T probably benign Het
Carmil3 C T 14: 55,502,396 P980L probably damaging Het
Coch T A 12: 51,593,625 M1K probably null Het
Cpt2 A T 4: 107,908,157 F137I probably damaging Het
Crem T C 18: 3,295,094 I112V probably benign Het
Cul9 A G 17: 46,520,476 probably null Het
Cyp3a41a T A 5: 145,713,564 I90F probably damaging Het
Cyp4f16 C T 17: 32,550,787 A457V possibly damaging Het
Ddx6 A G 9: 44,628,729 E318G probably damaging Het
Dip2b A G 15: 100,154,157 E213G probably benign Het
Dlx5 T C 6: 6,878,316 H238R probably damaging Het
Dnaic2 A C 11: 114,754,406 I556L probably benign Het
Dnmt1 C T 9: 20,912,225 V1147M possibly damaging Het
Egf G T 3: 129,740,015 Q59K probably benign Het
Ermp1 A T 19: 29,646,262 Y109* probably null Het
Fer1l6 T A 15: 58,573,601 Y573* probably null Het
Fmnl1 T C 11: 103,193,128 L503P probably damaging Het
Gnptab T G 10: 88,431,389 I447M probably damaging Het
Hgf G A 5: 16,578,450 D253N probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Igf2r T C 17: 12,710,645 T958A probably benign Het
Kcnd2 T A 6: 21,216,498 L67Q probably damaging Het
Kif5a A G 10: 127,243,724 V248A probably damaging Het
Krt33b A G 11: 100,029,563 I88T probably damaging Het
Lhx2 G A 2: 38,351,846 E25K possibly damaging Het
Mex3d C T 10: 80,381,698 G562R Het
Myom2 A T 8: 15,117,679 Y1088F probably null Het
Ncapg T A 5: 45,694,092 probably null Het
Nudc A C 4: 133,534,403 V190G possibly damaging Het
Obscn G T 11: 59,122,860 R1054S probably benign Het
Olfr1045 T C 2: 86,197,838 M305V probably benign Het
Olfr1510 A G 14: 52,410,711 W54R probably benign Het
Olfr651 T C 7: 104,553,482 S188P possibly damaging Het
Olfr683 T A 7: 105,143,937 M119L probably benign Het
Olfr710 A T 7: 106,944,173 V276E probably damaging Het
Olfr979 A G 9: 40,000,564 V221A probably benign Het
Pcdh10 A T 3: 45,383,572 R891S possibly damaging Het
Pcdh15 C T 10: 74,631,770 S1873L possibly damaging Het
Pcdh7 A G 5: 57,720,998 K632E probably benign Het
Pcdhgb8 G A 18: 37,763,427 A517T probably damaging Het
Ptgr2 A T 12: 84,292,298 probably benign Het
Racgap1 T A 15: 99,642,958 T4S probably benign Het
Rb1cc1 A G 1: 6,249,180 H941R probably benign Het
Reln T C 5: 22,103,435 H312R probably damaging Het
Rnf166 T A 8: 122,467,987 H208L probably damaging Het
Theg T C 10: 79,576,715 E314G probably damaging Het
Timeless T C 10: 128,250,426 S999P probably benign Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Tor1aip1 A T 1: 156,007,609 H349Q possibly damaging Het
Ttn T A 2: 76,920,460 E3415V probably benign Het
Vmn2r102 A T 17: 19,676,624 N78Y probably damaging Het
Wdr11 A T 7: 129,607,086 D427V probably damaging Het
Zer1 A T 2: 30,113,437 probably benign Het
Zfp516 T A 18: 82,957,108 M477K probably benign Het
Other mutations in Ptpn18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Ptpn18 APN 1 34463119 missense probably damaging 0.98
IGL01611:Ptpn18 APN 1 34459817 utr 5 prime probably benign
IGL01633:Ptpn18 APN 1 34471908 missense probably benign 0.03
IGL03379:Ptpn18 APN 1 34470257 unclassified probably null
R0848:Ptpn18 UTSW 1 34462702 missense probably damaging 1.00
R1400:Ptpn18 UTSW 1 34463506 critical splice donor site probably null
R1973:Ptpn18 UTSW 1 34463109 missense probably damaging 1.00
R2040:Ptpn18 UTSW 1 34470219 missense probably damaging 0.99
R2113:Ptpn18 UTSW 1 34471661 missense probably damaging 1.00
R2963:Ptpn18 UTSW 1 34471692 nonsense probably null
R4061:Ptpn18 UTSW 1 34472930 missense possibly damaging 0.66
R4062:Ptpn18 UTSW 1 34472930 missense possibly damaging 0.66
R4509:Ptpn18 UTSW 1 34462742 missense possibly damaging 0.49
R4522:Ptpn18 UTSW 1 34472960 missense probably benign
R4626:Ptpn18 UTSW 1 34471792 intron probably null
R4978:Ptpn18 UTSW 1 34469813 intron probably benign
R5260:Ptpn18 UTSW 1 34463510 splice site probably benign
R5335:Ptpn18 UTSW 1 34463178 missense probably damaging 1.00
R5481:Ptpn18 UTSW 1 34471663 missense possibly damaging 0.67
R5865:Ptpn18 UTSW 1 34471563 splice site probably benign
R7038:Ptpn18 UTSW 1 34459825 start codon destroyed probably null 1.00
R7225:Ptpn18 UTSW 1 34472846 missense possibly damaging 0.58
R7290:Ptpn18 UTSW 1 34462811 critical splice donor site probably null
R7411:Ptpn18 UTSW 1 34472192 critical splice donor site probably null
R7434:Ptpn18 UTSW 1 34473364 missense possibly damaging 0.75
R7441:Ptpn18 UTSW 1 34473335 missense probably benign 0.00
R7442:Ptpn18 UTSW 1 34462750 missense probably benign 0.02
R7462:Ptpn18 UTSW 1 34473364 missense possibly damaging 0.75
R7464:Ptpn18 UTSW 1 34473364 missense possibly damaging 0.75
R7465:Ptpn18 UTSW 1 34473364 missense possibly damaging 0.75
R7535:Ptpn18 UTSW 1 34473364 missense possibly damaging 0.75
R7537:Ptpn18 UTSW 1 34473364 missense possibly damaging 0.75
R7678:Ptpn18 UTSW 1 34473364 missense possibly damaging 0.75
R7689:Ptpn18 UTSW 1 34473364 missense possibly damaging 0.75
R7982:Ptpn18 UTSW 1 34469905 splice site probably null
X0065:Ptpn18 UTSW 1 34469891 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGGGCTGTCTAACCCAAG -3'
(R):5'- TCCATGCAGAAGCTAAGGAGTG -3'

Sequencing Primer
(F):5'- GCTGTCTAACCCAAGGCCCC -3'
(R):5'- GCTAAGGAGTGACAGGGTAAC -3'
Posted On2019-10-07