Mutagenetix > Incidental Mutation

Incidental Mutation 'R7537:Ptpn18'

583625

Institutional Source

Beutler Lab

Gene Symbol

Ptpn18

Ensembl Gene

ENSMUSG00000026126

Gene Name

protein tyrosine phosphatase, non-receptor type 18

Synonyms

PTP-K1, FLP1, PTP-HSCF, HSCF, Ptpk1

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.182) question?

Stock #

R7537 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

34459762-34475733 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 34473364 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 417 (D417N)

Ref Sequence

ENSEMBL: ENSMUSP00000027302 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027302] [ENSMUST00000188972] [ENSMUST00000190122]

AlphaFold

Q61152

Predicted Effect

possibly damaging
Transcript: ENSMUST00000027302
AA Change: D417N

PolyPhen 2 Score 0.754 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000027302
Gene: ENSMUSG00000026126
AA Change: D417N

Domain	Start	End	E-Value	Type
PTPc	25	293	7.77e-115	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000188972
AA Change: D68N

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)

Predicted Effect

probably benign
Transcript: ENSMUST00000190122

SMART Domains

Protein: ENSMUSP00000139885
Gene: ENSMUSG00000026126

Domain	Start	End	E-Value	Type
PTPc	2	269	9.1e-113	SMART

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.9%

Validation Efficiency

100% (63/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, the mitotic cycle, and oncogenic transformation. This PTP contains a PEST motif, which often serves as a protein-protein interaction domain, and may be related to protein intracellular half-live. This protein can differentially dephosphorylate autophosphorylated tyrosine kinases that are overexpressed in tumor tissues, and it appears to regulate HER2, a member of the epidermal growth factor receptor family of receptor tyrosine kinases. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2008]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	T	C	3: 122,173,988	L2229P	possibly damaging	Het
Acaca	T	A	11: 84,260,634	M786K	probably damaging	Het
Acta2	G	A	19: 34,252,531	T8I	probably benign	Het
Adap1	T	G	5: 139,293,173	E117D	possibly damaging	Het
Ap5z1	T	C	5: 142,477,298	S746P	probably benign	Het
Appl2	A	G	10: 83,617,428	I208T	possibly damaging	Het
Astn1	G	A	1: 158,667,638		probably null	Het
Astn1	A	G	1: 158,505,386	E346G	possibly damaging	Het
Atp23	T	A	10: 126,868,725	I180L	unknown	Het
Bean1	CT	C	8: 104,182,032		probably null	Het
Cdh23	A	T	10: 60,384,945	I1340N	probably benign	Het
Cdh8	G	A	8: 99,098,885	Q493*	probably null	Het
Ces1g	T	C	8: 93,319,827	I357V	probably benign	Het
Ddx46	A	G	13: 55,650,478	D226G	probably damaging	Het
Eea1	C	T	10: 95,994,905	Q143*	probably null	Het
Erlin2	G	T	8: 27,031,772		probably null	Het
Fat3	T	A	9: 15,938,319	D3929V	probably damaging	Het
Flt3	T	C	5: 147,334,437	D898G	probably damaging	Het
Gm16519	A	G	17: 70,929,356	N100S	probably benign	Het
Gnl1	A	G	17: 35,988,536	H533R	probably damaging	Het
Gphn	A	G	12: 78,504,680	T301A	possibly damaging	Het
Herc2	C	T	7: 56,219,779	R4295*	probably null	Het
Insm2	T	C	12: 55,599,518	S16P	possibly damaging	Het
Jak2	C	T	19: 29,298,637	T778I	probably benign	Het
Lrriq3	A	G	3: 155,101,097	T128A	probably damaging	Het
Lst1	A	G	17: 35,186,944		probably null	Het
Magi1	G	T	6: 93,708,110	Y762*	probably null	Het
Man2b1	T	A	8: 85,090,965	C358*	probably null	Het
Mga	T	C	2: 119,935,551	V1432A	probably damaging	Het
Mmp1a	TG	TGG	9: 7,465,083		probably null	Het
Morc2a	C	T	11: 3,683,566	Q587*	probably null	Het
Mrc2	T	C	11: 105,292,797	I4T	probably benign	Het
Muc16	C	A	9: 18,638,135	V5621F	probably benign	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Myo3b	A	G	2: 70,217,169	R340G	probably benign	Het
Nipal3	T	C	4: 135,490,937	Y34C	probably damaging	Het
Nktr	T	A	9: 121,749,279	D804E	unknown	Het
Nlrp4b	A	G	7: 10,714,889	M340V	probably benign	Het
Olfr1039	A	G	2: 86,131,264	V133A	probably benign	Het
Olfr385	T	A	11: 73,589,268	T157S	probably benign	Het
Olfr680-ps1	A	T	7: 105,092,771	M16K	probably benign	Het
Olfr701	G	A	7: 106,818,374	C97Y	probably damaging	Het
Pard3	T	A	8: 127,610,582	N1271K	probably damaging	Het
Pcdhb11	A	T	18: 37,421,619	M1L	possibly damaging	Het
Pclo	T	C	5: 14,682,104	V3540A	unknown	Het
Pemt	A	G	11: 59,976,844	F154S	probably damaging	Het
Rnpc3	G	T	3: 113,613,832	T376K	probably benign	Het
Rpe65	A	G	3: 159,604,609	Y143C	probably damaging	Het
Sbk2	T	C	7: 4,963,149	E12G	probably benign	Het
Slc2a5	T	C	4: 150,129,069	I106T	possibly damaging	Het
Snx13	A	G	12: 35,085,982	D92G	probably damaging	Het
Sorl1	C	T	9: 41,980,688	V1889I	probably benign	Het
Spag17	A	T	3: 99,939,247	N29I	possibly damaging	Het
Speg	T	C	1: 75,401,464	V878A	probably damaging	Het
Timp4	A	G	6: 115,250,460	S53P	probably damaging	Het
Tssk1	G	T	16: 17,895,084	E244D	probably benign	Het
Usp29	A	C	7: 6,961,220	T21P	possibly damaging	Het
Vmn2r85	A	T	10: 130,422,866	V440E	probably benign	Het
Wdr59	T	C	8: 111,490,369	D270G		Het
Zbbx	G	A	3: 75,085,519	P223S	probably damaging	Het
Zfp936	T	A	7: 43,189,815	C235*	probably null	Het
Zranb3	A	T	1: 128,032,847		probably null	Het

Other mutations in Ptpn18

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00488:Ptpn18	APN	1	34463119	missense	probably damaging	0.98
IGL01611:Ptpn18	APN	1	34459817	utr 5 prime	probably benign
IGL01633:Ptpn18	APN	1	34471908	missense	probably benign	0.03
IGL03379:Ptpn18	APN	1	34470257	splice site	probably null
R0848:Ptpn18	UTSW	1	34462702	missense	probably damaging	1.00
R1400:Ptpn18	UTSW	1	34463506	critical splice donor site	probably null
R1973:Ptpn18	UTSW	1	34463109	missense	probably damaging	1.00
R2040:Ptpn18	UTSW	1	34470219	missense	probably damaging	0.99
R2113:Ptpn18	UTSW	1	34471661	missense	probably damaging	1.00
R2963:Ptpn18	UTSW	1	34471692	nonsense	probably null
R4061:Ptpn18	UTSW	1	34472930	missense	possibly damaging	0.66
R4062:Ptpn18	UTSW	1	34472930	missense	possibly damaging	0.66
R4509:Ptpn18	UTSW	1	34462742	missense	possibly damaging	0.49
R4522:Ptpn18	UTSW	1	34472960	missense	probably benign
R4626:Ptpn18	UTSW	1	34471792	splice site	probably null
R4978:Ptpn18	UTSW	1	34469813	intron	probably benign
R5260:Ptpn18	UTSW	1	34463510	splice site	probably benign
R5335:Ptpn18	UTSW	1	34463178	missense	probably damaging	1.00
R5481:Ptpn18	UTSW	1	34471663	missense	possibly damaging	0.67
R5865:Ptpn18	UTSW	1	34471563	splice site	probably benign
R7038:Ptpn18	UTSW	1	34459825	start codon destroyed	probably null	1.00
R7225:Ptpn18	UTSW	1	34472846	missense	possibly damaging	0.58
R7290:Ptpn18	UTSW	1	34462811	critical splice donor site	probably null
R7411:Ptpn18	UTSW	1	34472192	critical splice donor site	probably null
R7434:Ptpn18	UTSW	1	34473364	missense	possibly damaging	0.75
R7441:Ptpn18	UTSW	1	34473335	missense	probably benign	0.00
R7442:Ptpn18	UTSW	1	34462750	missense	probably benign	0.02
R7462:Ptpn18	UTSW	1	34473364	missense	possibly damaging	0.75
R7463:Ptpn18	UTSW	1	34473364	missense	possibly damaging	0.75
R7464:Ptpn18	UTSW	1	34473364	missense	possibly damaging	0.75
R7465:Ptpn18	UTSW	1	34473364	missense	possibly damaging	0.75
R7535:Ptpn18	UTSW	1	34473364	missense	possibly damaging	0.75
R7678:Ptpn18	UTSW	1	34473364	missense	possibly damaging	0.75
R7689:Ptpn18	UTSW	1	34473364	missense	possibly damaging	0.75
R7899:Ptpn18	UTSW	1	34469905	splice site	probably null
R8543:Ptpn18	UTSW	1	34472148	missense	probably benign	0.00
R8821:Ptpn18	UTSW	1	34472190	missense	probably null	1.00
R8831:Ptpn18	UTSW	1	34472190	missense	probably null	1.00
R8858:Ptpn18	UTSW	1	34463115	missense	possibly damaging	0.88
R8879:Ptpn18	UTSW	1	34463130	missense	probably benign	0.23
R8924:Ptpn18	UTSW	1	34459885	missense	probably benign	0.02
R9657:Ptpn18	UTSW	1	34473392	missense	possibly damaging	0.87
X0065:Ptpn18	UTSW	1	34469891	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGACCTCCGAACTTGGACAC -3'
(R):5'- TGCGCAAGTTGAAGCCTAAGG -3'

Sequencing Primer
(F):5'- AACTTGGACACGCCCATGG -3'
(R):5'- GGCTCCATGCAGAAGCTAAG -3'

Posted On

2019-10-17