Incidental Mutation 'R5556:Mecom'
List |< first << previous [record 29 of 56] next >> last >|
ID435371
Institutional Source Beutler Lab
Gene Symbol Mecom
Ensembl Gene ENSMUSG00000027684
Gene NameMDS1 and EVI1 complex locus
SynonymsEvi1, Jbo, D630039M04Rik, ZNFPR1B1, Evi-1, Prdm3, Mds1, MDS1-EVI1
MMRRC Submission 043113-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5556 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location29951296-30548008 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30238100 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 87 (S87P)
Ref Sequence ENSEMBL: ENSMUSP00000134117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061088] [ENSMUST00000172697] [ENSMUST00000172754] [ENSMUST00000173495] [ENSMUST00000173899]
Predicted Effect probably damaging
Transcript: ENSMUST00000061088
AA Change: S74P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000051057
Gene: ENSMUSG00000027684
AA Change: S74P

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
Blast:SET 68 115 3e-27 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000172697
AA Change: S87P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134117
Gene: ENSMUSG00000027684
AA Change: S87P

DomainStartEndE-ValueType
SET 80 198 5.46e-15 SMART
ZnF_C2H2 211 231 1.86e1 SMART
ZnF_C2H2 265 287 4.47e-3 SMART
ZnF_C2H2 293 315 1.6e-4 SMART
ZnF_C2H2 321 344 1.13e-4 SMART
ZnF_C2H2 350 372 1.2e-3 SMART
ZnF_C2H2 378 400 8.22e-2 SMART
ZnF_C2H2 407 434 9.96e0 SMART
low complexity region 487 501 N/A INTRINSIC
low complexity region 601 613 N/A INTRINSIC
ZnF_C2H2 923 945 5.29e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172754
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173022
Predicted Effect unknown
Transcript: ENSMUST00000173059
AA Change: S21P
SMART Domains Protein: ENSMUSP00000133310
Gene: ENSMUSG00000027684
AA Change: S21P

DomainStartEndE-ValueType
SET 15 133 5.46e-15 SMART
ZnF_C2H2 146 166 1.86e1 SMART
ZnF_C2H2 200 222 4.47e-3 SMART
ZnF_C2H2 228 250 1.6e-4 SMART
ZnF_C2H2 256 279 1.13e-4 SMART
ZnF_C2H2 285 307 1.2e-3 SMART
ZnF_C2H2 525 547 5.29e-5 SMART
ZnF_C2H2 553 576 1.6e-4 SMART
ZnF_C2H2 582 604 5.9e-3 SMART
low complexity region 678 697 N/A INTRINSIC
low complexity region 826 841 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173411
Predicted Effect probably benign
Transcript: ENSMUST00000173495
SMART Domains Protein: ENSMUSP00000134626
Gene: ENSMUSG00000027684

DomainStartEndE-ValueType
ZnF_C2H2 21 41 8e-2 SMART
ZnF_C2H2 75 97 1.9e-5 SMART
ZnF_C2H2 103 125 7e-7 SMART
ZnF_C2H2 131 154 4.8e-7 SMART
ZnF_C2H2 160 182 5e-6 SMART
ZnF_C2H2 188 210 3.5e-4 SMART
ZnF_C2H2 217 244 4.3e-2 SMART
low complexity region 297 311 N/A INTRINSIC
low complexity region 411 423 N/A INTRINSIC
ZnF_C2H2 733 755 2.2e-7 SMART
ZnF_C2H2 761 784 7.1e-7 SMART
ZnF_C2H2 790 812 2.5e-5 SMART
low complexity region 886 905 N/A INTRINSIC
low complexity region 1034 1049 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000173899
AA Change: S87P
SMART Domains Protein: ENSMUSP00000133410
Gene: ENSMUSG00000027684
AA Change: S87P

DomainStartEndE-ValueType
SET 80 198 5.46e-15 SMART
ZnF_C2H2 211 231 1.86e1 SMART
ZnF_C2H2 265 287 4.47e-3 SMART
ZnF_C2H2 293 315 1.6e-4 SMART
ZnF_C2H2 321 344 1.13e-4 SMART
ZnF_C2H2 350 372 1.2e-3 SMART
ZnF_C2H2 378 400 8.22e-2 SMART
ZnF_C2H2 407 434 9.96e0 SMART
low complexity region 487 501 N/A INTRINSIC
low complexity region 601 613 N/A INTRINSIC
ZnF_C2H2 914 936 5.29e-5 SMART
ZnF_C2H2 942 965 1.6e-4 SMART
ZnF_C2H2 971 993 5.9e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195690
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcriptional regulator and oncoprotein that may be involved in hematopoiesis, apoptosis, development, and cell differentiation and proliferation. The encoded protein can interact with CTBP1, SMAD3, CREBBP, KAT2B, MAPK8, and MAPK9. This gene can undergo translocation with the AML1 gene, resulting in overexpression of this gene and the onset of leukemia. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Embryos homozygous for a targeted null mutation die at 10.5 dpc displaying widespread hypocellularity, hemorrhage, and disruption in the development of the heart, somites, and neural crest-derived cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C A 1: 105,693,167 Q456K probably benign Het
4933427D14Rik T A 11: 72,175,200 probably null Het
Abca13 A T 11: 9,258,546 I240F possibly damaging Het
Accs A G 2: 93,836,083 Y420H probably damaging Het
Aco2 T C 15: 81,889,319 Y20H probably damaging Het
Adck2 T C 6: 39,583,935 V419A probably benign Het
Bahd1 T A 2: 118,916,270 N123K probably damaging Het
BC027072 T C 17: 71,752,425 K86E possibly damaging Het
Cast A G 13: 74,695,889 probably null Het
Cd164l2 T A 4: 133,223,705 V157E probably damaging Het
Cdk11b C T 4: 155,634,147 Q185* probably null Het
Ces2g T C 8: 104,967,442 F470S probably benign Het
Cherp C G 8: 72,467,980 Q313H probably damaging Het
Chrna4 A G 2: 181,033,980 V110A possibly damaging Het
Cndp2 A G 18: 84,672,124 V231A probably benign Het
Cst7 A T 2: 150,570,568 H17L probably benign Het
Decr1 C T 4: 15,919,244 D300N probably damaging Het
Dennd4b G A 3: 90,268,368 R148Q probably damaging Het
Dgkb T G 12: 38,127,364 V230G probably damaging Het
Dis3l2 T C 1: 86,973,404 V439A possibly damaging Het
Disp3 C T 4: 148,258,157 G612D probably benign Het
Dock7 T C 4: 98,944,735 T1962A probably damaging Het
Fam189a1 A G 7: 64,856,209 F96S probably damaging Het
Fibp T A 19: 5,464,199 V304E possibly damaging Het
Flt3 T A 5: 147,332,997 probably null Het
Kifc3 G A 8: 95,108,459 Q233* probably null Het
Klhl42 C A 6: 147,108,112 S483Y probably benign Het
Map3k19 G A 1: 127,834,547 R276* probably null Het
Med13 A G 11: 86,327,838 V416A probably benign Het
Mepe G A 5: 104,338,212 G406D probably damaging Het
Met T G 6: 17,534,176 L673V probably benign Het
Mlh3 A T 12: 85,268,493 Y306* probably null Het
Nrxn2 C A 19: 6,490,091 A814E probably damaging Het
Nsmaf C T 4: 6,398,621 V828I probably benign Het
Olfr137 T A 17: 38,305,073 K129N possibly damaging Het
Olfr824 A T 10: 130,126,859 L66H probably damaging Het
Panx1 A G 9: 15,007,633 I310T possibly damaging Het
Pcdhb6 T A 18: 37,334,389 L121Q probably damaging Het
Plekha7 G A 7: 116,164,149 T406I probably benign Het
Prtg T C 9: 72,851,704 S447P probably damaging Het
Ptprr A G 10: 116,251,149 Y267C probably damaging Het
Rbpjl A G 2: 164,408,062 T134A probably benign Het
Rpe C A 1: 66,706,466 T55N probably damaging Het
Scn1a T C 2: 66,324,797 D606G probably benign Het
Setd5 T A 6: 113,147,502 N1105K probably benign Het
Sh3d21 T C 4: 126,162,236 N126D possibly damaging Het
Shank1 A G 7: 44,344,315 probably benign Het
Srgap3 T A 6: 112,739,078 D627V probably damaging Het
Tacc2 T A 7: 130,674,606 S1796T probably damaging Het
Tcrg-C4 A T 13: 19,352,307 R178S unknown Het
Tmco3 G A 8: 13,294,870 V217I probably damaging Het
Tspan10 A T 11: 120,444,715 Y217F possibly damaging Het
Usp3 G A 9: 66,544,021 T153M possibly damaging Het
Xdh G T 17: 73,897,764 T1067K probably benign Het
Zfp334 T C 2: 165,380,584 D513G probably benign Het
Other mutations in Mecom
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01978:Mecom APN 3 29963166 missense probably damaging 0.99
IGL02800:Mecom APN 3 29961034 missense probably damaging 1.00
IGL03052:Mecom APN 3 29960963 splice site probably benign
IGL03237:Mecom APN 3 29956499 intron probably benign
R0004:Mecom UTSW 3 29979911 missense probably damaging 1.00
R0299:Mecom UTSW 3 29980411 missense probably benign 0.41
R0324:Mecom UTSW 3 29963112 missense probably damaging 0.99
R0485:Mecom UTSW 3 29980972 intron probably benign
R0696:Mecom UTSW 3 29956389 missense probably benign 0.01
R1322:Mecom UTSW 3 29957373 missense probably damaging 0.98
R1396:Mecom UTSW 3 29979800 missense possibly damaging 0.50
R1419:Mecom UTSW 3 29980889 missense probably damaging 1.00
R1469:Mecom UTSW 3 29980048 missense probably damaging 1.00
R1469:Mecom UTSW 3 29980048 missense probably damaging 1.00
R1487:Mecom UTSW 3 29980064 missense probably damaging 1.00
R1620:Mecom UTSW 3 29987088 missense probably damaging 1.00
R1867:Mecom UTSW 3 30509428 critical splice donor site probably null
R1876:Mecom UTSW 3 29993658 missense probably damaging 1.00
R1922:Mecom UTSW 3 29957442 missense probably damaging 0.99
R2044:Mecom UTSW 3 29980592 missense probably damaging 1.00
R2087:Mecom UTSW 3 29952814 missense probably benign 0.01
R2116:Mecom UTSW 3 29965458 missense probably damaging 1.00
R3500:Mecom UTSW 3 29980912 missense probably damaging 1.00
R4348:Mecom UTSW 3 29966738 missense possibly damaging 0.72
R4350:Mecom UTSW 3 29966738 missense possibly damaging 0.72
R4351:Mecom UTSW 3 29966738 missense possibly damaging 0.72
R4352:Mecom UTSW 3 29966738 missense possibly damaging 0.72
R4353:Mecom UTSW 3 29966738 missense possibly damaging 0.72
R4358:Mecom UTSW 3 29979785 nonsense probably null
R4370:Mecom UTSW 3 29957355 missense probably damaging 1.00
R4380:Mecom UTSW 3 29987070 missense probably damaging 1.00
R4676:Mecom UTSW 3 30268668 intron probably benign
R4690:Mecom UTSW 3 30238310 missense probably benign 0.01
R4750:Mecom UTSW 3 29957530 missense probably damaging 0.97
R4812:Mecom UTSW 3 30140368 start codon destroyed probably null
R4821:Mecom UTSW 3 29985351 missense probably damaging 1.00
R4986:Mecom UTSW 3 29980699 missense probably damaging 0.99
R5020:Mecom UTSW 3 29961106 missense probably damaging 1.00
R5099:Mecom UTSW 3 29985316 intron probably benign
R5410:Mecom UTSW 3 29997721 missense probably benign 0.01
R5415:Mecom UTSW 3 29957526 missense possibly damaging 0.93
R5811:Mecom UTSW 3 29961000 missense probably benign 0.00
R5955:Mecom UTSW 3 29961046 missense probably damaging 1.00
R6153:Mecom UTSW 3 29993648 missense possibly damaging 0.92
R6321:Mecom UTSW 3 29980592 missense probably damaging 1.00
R6335:Mecom UTSW 3 29980756 missense probably damaging 1.00
R6383:Mecom UTSW 3 29997726 missense probably damaging 1.00
R6435:Mecom UTSW 3 29980249 missense probably damaging 1.00
R6468:Mecom UTSW 3 30140386 intron probably benign
R6476:Mecom UTSW 3 29980568 missense possibly damaging 0.70
R6673:Mecom UTSW 3 29980702 missense probably benign 0.09
R6721:Mecom UTSW 3 29979874 missense probably damaging 1.00
R7071:Mecom UTSW 3 29980708 missense probably damaging 1.00
R7095:Mecom UTSW 3 29980954 missense probably damaging 1.00
R7131:Mecom UTSW 3 29980945 missense probably damaging 1.00
R7247:Mecom UTSW 3 30140356 missense unknown
R7265:Mecom UTSW 3 29980133 missense possibly damaging 0.65
R7556:Mecom UTSW 3 29987071 missense probably benign 0.01
R7599:Mecom UTSW 3 29956385 missense probably damaging 0.96
R7609:Mecom UTSW 3 29956442 missense probably damaging 0.99
R7844:Mecom UTSW 3 30009824 missense unknown
R8047:Mecom UTSW 3 30238255 missense
R8070:Mecom UTSW 3 29979838 missense probably damaging 1.00
R8316:Mecom UTSW 3 29957380 missense probably benign 0.01
R8351:Mecom UTSW 3 29985370 missense probably benign 0.00
R8451:Mecom UTSW 3 29985370 missense probably benign 0.00
R8757:Mecom UTSW 3 30238119 missense
Predicted Primers PCR Primer
(F):5'- ATGCTCACAAATGGAATATCCGC -3'
(R):5'- AAGAAATGCCAGATGCTGATGC -3'

Sequencing Primer
(F):5'- TGGAATATCCGCATAGCCACCTATG -3'
(R):5'- TGCTGATGCAGATGGGATAACC -3'
Posted On2016-10-24