Incidental Mutation 'R5646:Smg1'
ID 441156
Institutional Source Beutler Lab
Gene Symbol Smg1
Ensembl Gene ENSMUSG00000030655
Gene Name SMG1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)
Synonyms 2610207I05Rik, 5430435M13Rik, C130002K18Rik
MMRRC Submission 043294-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R5646 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 118131308-118243670 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 118212559 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 65 (N65K)
Ref Sequence ENSEMBL: ENSMUSP00000137172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032891] [ENSMUST00000179047]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000032891
AA Change: N89K
SMART Domains Protein: ENSMUSP00000032891
Gene: ENSMUSG00000030655
AA Change: N89K

DomainStartEndE-ValueType
low complexity region 42 55 N/A INTRINSIC
SCOP:d1gw5a_ 147 621 7e-7 SMART
Pfam:SMG1 629 1240 9.8e-249 PFAM
low complexity region 1540 1551 N/A INTRINSIC
SCOP:d1gw5a_ 1680 1942 8e-3 SMART
low complexity region 2125 2141 N/A INTRINSIC
PI3Kc 2149 2493 7.93e-50 SMART
low complexity region 2759 2770 N/A INTRINSIC
low complexity region 3425 3442 N/A INTRINSIC
FATC 3626 3658 8.66e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179047
AA Change: N65K

PolyPhen 2 Score 0.418 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000137172
Gene: ENSMUSG00000030655
AA Change: N65K

DomainStartEndE-ValueType
low complexity region 18 31 N/A INTRINSIC
SCOP:d1gw5a_ 123 282 7e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179331
SMART Domains Protein: ENSMUSP00000137592
Gene: ENSMUSG00000030655

DomainStartEndE-ValueType
low complexity region 18 31 N/A INTRINSIC
SCOP:d1gw5a_ 71 545 1e-6 SMART
low complexity region 602 612 N/A INTRINSIC
low complexity region 631 646 N/A INTRINSIC
low complexity region 698 718 N/A INTRINSIC
low complexity region 898 915 N/A INTRINSIC
low complexity region 1135 1147 N/A INTRINSIC
low complexity region 1464 1475 N/A INTRINSIC
low complexity region 2049 2065 N/A INTRINSIC
PI3Kc 2073 2417 7.93e-50 SMART
low complexity region 2683 2694 N/A INTRINSIC
low complexity region 3349 3366 N/A INTRINSIC
FATC 3550 3582 8.66e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179847
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180009
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208209
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in nonsense-mediated mRNA decay (NMD) as part of the mRNA surveillance complex. The protein has kinase activity and is thought to function in NMD by phosphorylating the regulator of nonsense transcripts 1 protein. Alternatively spliced transcript variants have been described, but their full-length nature has yet to be determined. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit early embryonic lethality. Mice heteroygous for a gene trap allele exhibit abnormal tooth development, chronic inflammation, increased body weight, increased incidence of tumor formation and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,283,776 S4467P probably damaging Het
Add1 C A 5: 34,630,680 A691D probably benign Het
Agap3 C A 5: 24,483,397 D394E probably benign Het
Arhgef11 T C 3: 87,684,486 V59A possibly damaging Het
Atp2a1 A G 7: 126,453,105 V402A probably benign Het
Bbs9 T C 9: 22,578,715 F261L probably benign Het
Bsn A T 9: 108,110,432 probably benign Het
Camk1 A G 6: 113,339,340 V81A probably damaging Het
Cass4 T G 2: 172,416,245 C54W probably damaging Het
Ccdc39 A T 3: 33,825,550 F456L probably damaging Het
Cdc42bpa A G 1: 180,106,094 E766G probably damaging Het
Cdcp2 T C 4: 107,105,142 C171R probably damaging Het
Cdh9 G A 15: 16,823,285 E118K probably damaging Het
Col4a2 G A 8: 11,441,281 G1227R probably damaging Het
Cyp2d9 A G 15: 82,452,464 T5A probably benign Het
Dlg5 T A 14: 24,158,699 D813V probably damaging Het
Dmtf1 G A 5: 9,124,515 S405F possibly damaging Het
Drd2 A G 9: 49,404,912 K324R probably benign Het
Ergic1 T C 17: 26,614,358 S29P probably damaging Het
Fmnl1 A G 11: 103,196,512 probably benign Het
Foxd2 C T 4: 114,908,635 A63T unknown Het
Gfap T C 11: 102,891,456 I409M probably benign Het
Gfpt1 A G 6: 87,042,999 M1V probably null Het
H2-T23 C G 17: 36,031,803 E148Q possibly damaging Het
Hip1 G A 5: 135,428,741 R704W probably damaging Het
Kif19a A C 11: 114,779,654 D130A probably damaging Het
Lin7b T C 7: 45,369,193 D14G probably damaging Het
Meioc T A 11: 102,675,257 N510K possibly damaging Het
Mettl5 C A 2: 69,881,319 G68* probably null Het
Mitf A T 6: 98,013,694 I184F probably damaging Het
Mmp9 T A 2: 164,949,050 H119Q probably benign Het
Mycbp2 T A 14: 103,169,910 H2768L probably benign Het
Myh2 A T 11: 67,188,812 I1032F probably benign Het
Myo3b T C 2: 70,314,430 I1110T probably damaging Het
Nde1 T C 16: 14,169,514 F8L probably damaging Het
Olfr1317 T C 2: 112,142,683 V246A possibly damaging Het
Olfr202 C T 16: 59,283,979 V173I probably benign Het
Olfr432 C T 1: 174,051,287 Q305* probably null Het
Olfr447 A G 6: 42,911,523 probably null Het
Olfr550 A C 7: 102,579,305 Y270S possibly damaging Het
Olfr753-ps1 T C 17: 37,169,917 I244V probably benign Het
Olfr771 T C 10: 129,160,837 D49G possibly damaging Het
Pcdhga8 A G 18: 37,726,770 H293R probably benign Het
Pde7a A T 3: 19,233,773 L244Q probably damaging Het
Pex14 T C 4: 148,961,453 D340G probably benign Het
Pfkfb4 A T 9: 109,008,421 I195F probably damaging Het
Pik3c2a C A 7: 116,405,951 G361W probably damaging Het
Prkcg T A 7: 3,329,081 M517K probably damaging Het
Prob1 A T 18: 35,654,114 F362L probably benign Het
Rims4 C T 2: 163,864,017 W232* probably null Het
Robo2 T C 16: 73,961,819 D688G probably damaging Het
Sec24c C A 14: 20,679,573 A73E probably benign Het
Slc15a3 A G 19: 10,843,210 N64D probably benign Het
Sptb G T 12: 76,587,441 D2165E probably benign Het
Sptbn5 A T 2: 120,048,811 noncoding transcript Het
Syt12 A T 19: 4,456,541 M192K possibly damaging Het
Tas2r107 A G 6: 131,659,708 V126A probably benign Het
Thbs3 T C 3: 89,219,098 L242P probably damaging Het
Timp2 A T 11: 118,317,532 probably null Het
Tmtc1 G A 6: 148,246,831 A751V probably damaging Het
Tnni2 A T 7: 142,443,913 D85V probably damaging Het
Ttc39b G A 4: 83,244,070 P319L probably damaging Het
Ttc6 A T 12: 57,576,019 K68M probably damaging Het
Usp25 G A 16: 77,050,472 R156Q probably benign Het
Vill A T 9: 119,071,162 D365V probably damaging Het
Vmn1r65 T A 7: 6,009,224 T4S probably benign Het
Vmn2r76 C A 7: 86,226,053 C572F probably damaging Het
Vps26a A C 10: 62,468,298 N181K probably damaging Het
Xirp2 T C 2: 67,510,790 L1125P probably damaging Het
Zbtb41 T G 1: 139,423,763 S205A probably benign Het
Zfp438 T C 18: 5,214,526 D144G probably benign Het
Zfp600 T C 4: 146,195,100 S113P probably damaging Het
Zfp84 C T 7: 29,776,393 T170M probably benign Het
Zmiz2 T A 11: 6,402,837 D654E probably damaging Het
Zswim4 A T 8: 84,231,110 probably null Het
Other mutations in Smg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Smg1 APN 7 118198271 utr 3 prime probably benign
IGL00481:Smg1 APN 7 118210794 missense possibly damaging 0.67
IGL00503:Smg1 APN 7 118185483 utr 3 prime probably benign
IGL00927:Smg1 APN 7 118140632 missense probably damaging 1.00
IGL01333:Smg1 APN 7 118163378 splice site probably benign
IGL01344:Smg1 APN 7 118190836 utr 3 prime probably benign
IGL01397:Smg1 APN 7 118163221 utr 3 prime probably benign
IGL01403:Smg1 APN 7 118158132 utr 3 prime probably benign
IGL01573:Smg1 APN 7 118167962 utr 3 prime probably benign
IGL01872:Smg1 APN 7 118148944 utr 3 prime probably benign
IGL02010:Smg1 APN 7 118186146 utr 3 prime probably benign
IGL02158:Smg1 APN 7 118212946 missense possibly damaging 0.77
IGL02268:Smg1 APN 7 118182541 missense probably benign 0.19
IGL02314:Smg1 APN 7 118154709 utr 3 prime probably benign
IGL02552:Smg1 APN 7 118195894 utr 3 prime probably benign
IGL02577:Smg1 APN 7 118203122 missense probably damaging 0.99
IGL02859:Smg1 APN 7 118148933 utr 3 prime probably benign
IGL02890:Smg1 APN 7 118185501 utr 3 prime probably benign
IGL02892:Smg1 APN 7 118167955 utr 3 prime probably benign
IGL03119:Smg1 APN 7 118195113 utr 3 prime probably benign
IGL03123:Smg1 APN 7 118157181 utr 3 prime probably benign
IGL03128:Smg1 APN 7 118203059 missense probably benign 0.03
IGL03184:Smg1 APN 7 118180380 missense possibly damaging 0.86
PIT4508001:Smg1 UTSW 7 118185541 missense unknown
R0010:Smg1 UTSW 7 118171859 utr 3 prime probably benign
R0010:Smg1 UTSW 7 118171859 utr 3 prime probably benign
R0025:Smg1 UTSW 7 118212443 missense possibly damaging 0.92
R0025:Smg1 UTSW 7 118212443 missense possibly damaging 0.92
R0098:Smg1 UTSW 7 118145467 missense probably benign 0.02
R0139:Smg1 UTSW 7 118152675 critical splice donor site probably null
R0371:Smg1 UTSW 7 118168300 utr 3 prime probably benign
R0415:Smg1 UTSW 7 118182468 missense probably benign 0.34
R0416:Smg1 UTSW 7 118184461 splice site probably benign
R0423:Smg1 UTSW 7 118176880 missense possibly damaging 0.53
R0600:Smg1 UTSW 7 118160383 utr 3 prime probably benign
R0626:Smg1 UTSW 7 118182383 missense possibly damaging 0.82
R0627:Smg1 UTSW 7 118167861 utr 3 prime probably benign
R0727:Smg1 UTSW 7 118166422 utr 3 prime probably benign
R0729:Smg1 UTSW 7 118146289 utr 3 prime probably benign
R0841:Smg1 UTSW 7 118143301 missense possibly damaging 0.96
R1114:Smg1 UTSW 7 118159790 utr 3 prime probably benign
R1256:Smg1 UTSW 7 118203087 missense probably damaging 1.00
R1298:Smg1 UTSW 7 118168211 utr 3 prime probably benign
R1370:Smg1 UTSW 7 118159752 utr 3 prime probably benign
R1591:Smg1 UTSW 7 118156919 utr 3 prime probably benign
R1736:Smg1 UTSW 7 118165967 splice site probably null
R1755:Smg1 UTSW 7 118203064 nonsense probably null
R1765:Smg1 UTSW 7 118139715 missense probably benign 0.03
R1789:Smg1 UTSW 7 118145798 missense possibly damaging 0.73
R1845:Smg1 UTSW 7 118154622 utr 3 prime probably benign
R1908:Smg1 UTSW 7 118154199 utr 3 prime probably benign
R1909:Smg1 UTSW 7 118154199 utr 3 prime probably benign
R1942:Smg1 UTSW 7 118158103 utr 3 prime probably benign
R2064:Smg1 UTSW 7 118156867 utr 3 prime probably benign
R2072:Smg1 UTSW 7 118163166 utr 3 prime probably benign
R2154:Smg1 UTSW 7 118158076 utr 3 prime probably benign
R2895:Smg1 UTSW 7 118189143 utr 3 prime probably benign
R2915:Smg1 UTSW 7 118210879 splice site probably benign
R3416:Smg1 UTSW 7 118148853 utr 3 prime probably benign
R3417:Smg1 UTSW 7 118148853 utr 3 prime probably benign
R3873:Smg1 UTSW 7 118154662 utr 3 prime probably benign
R4082:Smg1 UTSW 7 118160246 utr 3 prime probably benign
R4230:Smg1 UTSW 7 118148733 critical splice donor site probably null
R4304:Smg1 UTSW 7 118139518 missense probably benign 0.03
R4549:Smg1 UTSW 7 118159683 utr 3 prime probably benign
R4571:Smg1 UTSW 7 118139465 missense possibly damaging 0.72
R4638:Smg1 UTSW 7 118195926 utr 3 prime probably benign
R4642:Smg1 UTSW 7 118154264 utr 3 prime probably benign
R4656:Smg1 UTSW 7 118212951 missense probably benign 0.00
R4754:Smg1 UTSW 7 118156731 utr 3 prime probably benign
R4798:Smg1 UTSW 7 118180474 missense probably benign 0.32
R4906:Smg1 UTSW 7 118152408 utr 3 prime probably benign
R4978:Smg1 UTSW 7 118154247 utr 3 prime probably benign
R4989:Smg1 UTSW 7 118158100 utr 3 prime probably benign
R4989:Smg1 UTSW 7 118208051 missense probably benign
R5026:Smg1 UTSW 7 118193545 utr 3 prime probably benign
R5124:Smg1 UTSW 7 118213012 missense probably benign 0.00
R5318:Smg1 UTSW 7 118160204 utr 3 prime probably benign
R5356:Smg1 UTSW 7 118195133 utr 3 prime probably benign
R5404:Smg1 UTSW 7 118206908 missense probably damaging 1.00
R5423:Smg1 UTSW 7 118146071 missense possibly damaging 0.70
R5441:Smg1 UTSW 7 118195081 utr 3 prime probably benign
R5490:Smg1 UTSW 7 118139436 missense possibly damaging 0.86
R5541:Smg1 UTSW 7 118157163 utr 3 prime probably benign
R5564:Smg1 UTSW 7 118189819 utr 3 prime probably benign
R5580:Smg1 UTSW 7 118148902 utr 3 prime probably benign
R5600:Smg1 UTSW 7 118167884 utr 3 prime probably benign
R5628:Smg1 UTSW 7 118154701 utr 3 prime probably benign
R5656:Smg1 UTSW 7 118154664 utr 3 prime probably benign
R5660:Smg1 UTSW 7 118143347 missense probably benign 0.33
R5706:Smg1 UTSW 7 118145590 missense possibly damaging 0.86
R5786:Smg1 UTSW 7 118212897 missense probably benign 0.12
R5890:Smg1 UTSW 7 118190586 utr 3 prime probably benign
R5912:Smg1 UTSW 7 118154586 utr 3 prime probably benign
R5977:Smg1 UTSW 7 118141357 utr 3 prime probably benign
R5993:Smg1 UTSW 7 118140509 missense probably benign 0.33
R6161:Smg1 UTSW 7 118163330 utr 3 prime probably benign
R6187:Smg1 UTSW 7 118189163 utr 3 prime probably benign
R6264:Smg1 UTSW 7 118166087 utr 3 prime probably benign
R6331:Smg1 UTSW 7 118154277 utr 3 prime probably benign
R6561:Smg1 UTSW 7 118166077 utr 3 prime probably benign
R6571:Smg1 UTSW 7 118184514 utr 3 prime probably benign
R6736:Smg1 UTSW 7 118157166 utr 3 prime probably benign
R6752:Smg1 UTSW 7 118163316 utr 3 prime probably benign
R6777:Smg1 UTSW 7 118189117 utr 3 prime probably benign
R6788:Smg1 UTSW 7 118184571 utr 3 prime probably benign
R6883:Smg1 UTSW 7 118168180 utr 3 prime probably benign
R6991:Smg1 UTSW 7 118167868 utr 3 prime probably benign
R7056:Smg1 UTSW 7 118146400 splice site probably benign
R7058:Smg1 UTSW 7 118198279 utr 3 prime probably benign
R7100:Smg1 UTSW 7 118184520 missense unknown
R7133:Smg1 UTSW 7 118152908 missense unknown
R7221:Smg1 UTSW 7 118182797 missense possibly damaging 0.86
R7229:Smg1 UTSW 7 118176955 missense probably benign 0.03
R7293:Smg1 UTSW 7 118166099 missense unknown
R7361:Smg1 UTSW 7 118184977 missense unknown
R7438:Smg1 UTSW 7 118195893 missense unknown
R7686:Smg1 UTSW 7 118167858 missense unknown
R7798:Smg1 UTSW 7 118171939 missense possibly damaging 0.73
R7908:Smg1 UTSW 7 118186134 missense unknown
R7923:Smg1 UTSW 7 118143322 missense possibly damaging 0.96
R7978:Smg1 UTSW 7 118193655 missense unknown
R7997:Smg1 UTSW 7 118173141 missense unknown
R7997:Smg1 UTSW 7 118173142 missense unknown
R8025:Smg1 UTSW 7 118206989 nonsense probably null
R8056:Smg1 UTSW 7 118160366 missense unknown
R8061:Smg1 UTSW 7 118152387 missense unknown
R8095:Smg1 UTSW 7 118173062 missense unknown
R8198:Smg1 UTSW 7 118145606 missense probably benign 0.03
R8399:Smg1 UTSW 7 118190571 missense unknown
R8445:Smg1 UTSW 7 118136977 missense possibly damaging 0.72
R8519:Smg1 UTSW 7 118171759 utr 3 prime probably benign
R8817:Smg1 UTSW 7 118159664 missense unknown
R8832:Smg1 UTSW 7 118139783 missense probably benign 0.33
R8855:Smg1 UTSW 7 118206899 missense unknown
R8866:Smg1 UTSW 7 118206899 missense unknown
R8946:Smg1 UTSW 7 118152677 missense probably null
R8954:Smg1 UTSW 7 118206992 missense probably damaging 1.00
R8967:Smg1 UTSW 7 118166516 missense unknown
R9072:Smg1 UTSW 7 118183809 missense unknown
R9090:Smg1 UTSW 7 118212563 missense unknown
R9156:Smg1 UTSW 7 118154661 missense unknown
R9198:Smg1 UTSW 7 118195956 missense unknown
R9240:Smg1 UTSW 7 118139808 missense probably benign 0.18
R9271:Smg1 UTSW 7 118212563 missense unknown
R9289:Smg1 UTSW 7 118145416 missense possibly damaging 0.53
R9378:Smg1 UTSW 7 118178775 nonsense probably null
R9396:Smg1 UTSW 7 118208080 missense unknown
R9469:Smg1 UTSW 7 118140551 missense possibly damaging 0.72
R9539:Smg1 UTSW 7 118145753 missense probably benign 0.03
R9549:Smg1 UTSW 7 118196031 missense unknown
R9563:Smg1 UTSW 7 118212985 missense unknown
R9564:Smg1 UTSW 7 118212985 missense unknown
R9597:Smg1 UTSW 7 118213047 missense unknown
Z1088:Smg1 UTSW 7 118154635 utr 3 prime probably benign
Z1088:Smg1 UTSW 7 118168661 nonsense probably null
Z1088:Smg1 UTSW 7 118178399 missense possibly damaging 0.96
Z1176:Smg1 UTSW 7 118206887 missense unknown
Z1176:Smg1 UTSW 7 118206907 missense unknown
Z1177:Smg1 UTSW 7 118168608 missense probably null
Z1177:Smg1 UTSW 7 118213033 missense unknown
Predicted Primers PCR Primer
(F):5'- AATGTGTCAACCCTGGTCTC -3'
(R):5'- GGTTCTTCCAGGCTACTGTC -3'

Sequencing Primer
(F):5'- GTGTCAACCCTGGTCTCCAAGTC -3'
(R):5'- GCTTAAAGCATCTGTCTGAATTGAAC -3'
Posted On 2016-11-08