Incidental Mutation 'R0371:Smg1'
ID 30475
Institutional Source Beutler Lab
Gene Symbol Smg1
Ensembl Gene ENSMUSG00000030655
Gene Name SMG1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)
Synonyms 2610207I05Rik, 5430435M13Rik, C130002K18Rik
MMRRC Submission 038577-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R0371 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 118131308-118243670 bp(-) (GRCm38)
Type of Mutation utr 3 prime
DNA Base Change (assembly) T to A at 118168300 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000032891]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000032891
AA Change: T1691S
SMART Domains Protein: ENSMUSP00000032891
Gene: ENSMUSG00000030655
AA Change: T1691S

DomainStartEndE-ValueType
low complexity region 42 55 N/A INTRINSIC
SCOP:d1gw5a_ 147 621 7e-7 SMART
Pfam:SMG1 629 1240 9.8e-249 PFAM
low complexity region 1540 1551 N/A INTRINSIC
SCOP:d1gw5a_ 1680 1942 8e-3 SMART
low complexity region 2125 2141 N/A INTRINSIC
PI3Kc 2149 2493 7.93e-50 SMART
low complexity region 2759 2770 N/A INTRINSIC
low complexity region 3425 3442 N/A INTRINSIC
FATC 3626 3658 8.66e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179331
SMART Domains Protein: ENSMUSP00000137592
Gene: ENSMUSG00000030655

DomainStartEndE-ValueType
low complexity region 18 31 N/A INTRINSIC
SCOP:d1gw5a_ 71 545 1e-6 SMART
low complexity region 602 612 N/A INTRINSIC
low complexity region 631 646 N/A INTRINSIC
low complexity region 698 718 N/A INTRINSIC
low complexity region 898 915 N/A INTRINSIC
low complexity region 1135 1147 N/A INTRINSIC
low complexity region 1464 1475 N/A INTRINSIC
low complexity region 2049 2065 N/A INTRINSIC
PI3Kc 2073 2417 7.93e-50 SMART
low complexity region 2683 2694 N/A INTRINSIC
low complexity region 3349 3366 N/A INTRINSIC
FATC 3550 3582 8.66e-12 SMART
Meta Mutation Damage Score 0.0595 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 90.6%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in nonsense-mediated mRNA decay (NMD) as part of the mRNA surveillance complex. The protein has kinase activity and is thought to function in NMD by phosphorylating the regulator of nonsense transcripts 1 protein. Alternatively spliced transcript variants have been described, but their full-length nature has yet to be determined. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit early embryonic lethality. Mice heteroygous for a gene trap allele exhibit abnormal tooth development, chronic inflammation, increased body weight, increased incidence of tumor formation and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 G A 16: 4,288,047 R1068C probably benign Het
Afmid C T 11: 117,835,140 probably benign Het
Aqr A G 2: 114,157,604 V159A possibly damaging Het
Atp6v0d2 G C 4: 19,880,033 T288R possibly damaging Het
Btnl1 T C 17: 34,381,057 V178A probably damaging Het
Ccdc110 T A 8: 45,942,806 M578K possibly damaging Het
Ccdc38 G T 10: 93,562,812 E51* probably null Het
Cep290 T A 10: 100,518,564 probably benign Het
Cilp2 T C 8: 69,881,606 E914G probably damaging Het
Col6a2 T C 10: 76,614,473 N208S probably benign Het
Ctrb1 T A 8: 111,687,151 I194F probably benign Het
Cyp4a12a C G 4: 115,326,683 R229G probably damaging Het
Dach1 C T 14: 97,969,903 V337M probably damaging Het
Dcbld2 A G 16: 58,450,823 N321S probably benign Het
Enpep C T 3: 129,283,867 probably null Het
Fat1 T C 8: 44,951,892 L560P probably damaging Het
Fdxr T C 11: 115,276,089 H58R possibly damaging Het
Filip1 G T 9: 79,860,091 P147T probably damaging Het
Fras1 G A 5: 96,555,331 E318K possibly damaging Het
Gm4759 A T 7: 106,422,779 C339S unknown Het
Grk2 T C 19: 4,291,586 probably null Het
Havcr1 T C 11: 46,752,589 I112T possibly damaging Het
Hjurp G A 1: 88,277,368 probably benign Het
Ildr2 G A 1: 166,303,564 V330I probably damaging Het
Ino80d T C 1: 63,057,956 probably benign Het
Iqsec1 A G 6: 90,670,403 probably benign Het
Irf2bpl C T 12: 86,881,643 W752* probably null Het
Kdr T A 5: 75,941,834 H1211L probably benign Het
Klri2 A G 6: 129,732,143 *249R probably null Het
Ktn1 A T 14: 47,724,003 K1054* probably null Het
Lactb2 A G 1: 13,650,760 S83P possibly damaging Het
Lrrc3b A T 14: 15,358,560 C15* probably null Het
Mrs2 T C 13: 24,993,095 I430V probably benign Het
Myo3b C T 2: 70,252,960 probably benign Het
Nbas C T 12: 13,331,095 T696I probably damaging Het
Nsun6 T C 2: 15,030,087 D240G probably damaging Het
Nup107 T C 10: 117,763,769 E615G probably damaging Het
Olfr1283 A T 2: 111,369,153 I174L probably benign Het
Olfr205 A G 16: 59,329,222 C96R possibly damaging Het
Olfr411 T A 11: 74,346,934 I217F probably damaging Het
Olfr447 A T 6: 42,911,938 R138S probably benign Het
Pabpc1l G A 2: 164,035,272 V256M probably benign Het
Sf3b2 C T 19: 5,274,824 D845N probably damaging Het
Sik1 T C 17: 31,848,984 D409G probably benign Het
Slc22a22 A T 15: 57,249,735 D369E possibly damaging Het
Snap29 C A 16: 17,406,203 D27E probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Sorcs3 A G 19: 48,603,894 I333V probably benign Het
Spag7 A G 11: 70,664,796 M105T probably damaging Het
Srgap3 A T 6: 112,771,471 S407T probably damaging Het
Supt6 T C 11: 78,223,157 N854S probably benign Het
Syne2 T C 12: 75,933,845 S1460P probably damaging Het
Taok3 C T 5: 117,206,687 Q160* probably null Het
Tchhl1 C A 3: 93,469,577 A27E probably damaging Het
Tet1 T C 10: 62,878,399 D539G probably damaging Het
Tut1 T C 19: 8,962,773 F374L probably damaging Het
Unc5c C T 3: 141,827,522 P770S probably benign Het
Vmn2r101 T A 17: 19,590,132 N393K probably benign Het
Vmn2r94 T A 17: 18,257,294 H285L probably benign Het
Wdr62 G A 7: 30,242,158 S700L possibly damaging Het
Wscd1 A G 11: 71,788,723 D474G probably damaging Het
Zcchc7 A G 4: 44,762,190 N106S probably damaging Het
Zfp345 G T 2: 150,472,063 T518N possibly damaging Het
Zfp648 A T 1: 154,204,667 S191C possibly damaging Het
Zkscan8 C T 13: 21,526,674 E89K probably damaging Het
Other mutations in Smg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Smg1 APN 7 118198271 utr 3 prime probably benign
IGL00481:Smg1 APN 7 118210794 missense possibly damaging 0.67
IGL00503:Smg1 APN 7 118185483 utr 3 prime probably benign
IGL00927:Smg1 APN 7 118140632 missense probably damaging 1.00
IGL01333:Smg1 APN 7 118163378 splice site probably benign
IGL01344:Smg1 APN 7 118190836 utr 3 prime probably benign
IGL01397:Smg1 APN 7 118163221 utr 3 prime probably benign
IGL01403:Smg1 APN 7 118158132 utr 3 prime probably benign
IGL01573:Smg1 APN 7 118167962 utr 3 prime probably benign
IGL01872:Smg1 APN 7 118148944 utr 3 prime probably benign
IGL02010:Smg1 APN 7 118186146 utr 3 prime probably benign
IGL02158:Smg1 APN 7 118212946 missense possibly damaging 0.77
IGL02268:Smg1 APN 7 118182541 missense probably benign 0.19
IGL02314:Smg1 APN 7 118154709 utr 3 prime probably benign
IGL02552:Smg1 APN 7 118195894 utr 3 prime probably benign
IGL02577:Smg1 APN 7 118203122 missense probably damaging 0.99
IGL02859:Smg1 APN 7 118148933 utr 3 prime probably benign
IGL02890:Smg1 APN 7 118185501 utr 3 prime probably benign
IGL02892:Smg1 APN 7 118167955 utr 3 prime probably benign
IGL03119:Smg1 APN 7 118195113 utr 3 prime probably benign
IGL03123:Smg1 APN 7 118157181 utr 3 prime probably benign
IGL03128:Smg1 APN 7 118203059 missense probably benign 0.03
IGL03184:Smg1 APN 7 118180380 missense possibly damaging 0.86
PIT4508001:Smg1 UTSW 7 118185541 missense unknown
R0010:Smg1 UTSW 7 118171859 utr 3 prime probably benign
R0010:Smg1 UTSW 7 118171859 utr 3 prime probably benign
R0025:Smg1 UTSW 7 118212443 missense possibly damaging 0.92
R0025:Smg1 UTSW 7 118212443 missense possibly damaging 0.92
R0098:Smg1 UTSW 7 118145467 missense probably benign 0.02
R0139:Smg1 UTSW 7 118152675 critical splice donor site probably null
R0415:Smg1 UTSW 7 118182468 missense probably benign 0.34
R0416:Smg1 UTSW 7 118184461 splice site probably benign
R0423:Smg1 UTSW 7 118176880 missense possibly damaging 0.53
R0600:Smg1 UTSW 7 118160383 utr 3 prime probably benign
R0626:Smg1 UTSW 7 118182383 missense possibly damaging 0.82
R0627:Smg1 UTSW 7 118167861 utr 3 prime probably benign
R0727:Smg1 UTSW 7 118166422 utr 3 prime probably benign
R0729:Smg1 UTSW 7 118146289 utr 3 prime probably benign
R0841:Smg1 UTSW 7 118143301 missense possibly damaging 0.96
R1114:Smg1 UTSW 7 118159790 utr 3 prime probably benign
R1256:Smg1 UTSW 7 118203087 missense probably damaging 1.00
R1298:Smg1 UTSW 7 118168211 utr 3 prime probably benign
R1370:Smg1 UTSW 7 118159752 utr 3 prime probably benign
R1591:Smg1 UTSW 7 118156919 utr 3 prime probably benign
R1736:Smg1 UTSW 7 118165967 splice site probably null
R1755:Smg1 UTSW 7 118203064 nonsense probably null
R1765:Smg1 UTSW 7 118139715 missense probably benign 0.03
R1789:Smg1 UTSW 7 118145798 missense possibly damaging 0.73
R1845:Smg1 UTSW 7 118154622 utr 3 prime probably benign
R1908:Smg1 UTSW 7 118154199 utr 3 prime probably benign
R1909:Smg1 UTSW 7 118154199 utr 3 prime probably benign
R1942:Smg1 UTSW 7 118158103 utr 3 prime probably benign
R2064:Smg1 UTSW 7 118156867 utr 3 prime probably benign
R2072:Smg1 UTSW 7 118163166 utr 3 prime probably benign
R2154:Smg1 UTSW 7 118158076 utr 3 prime probably benign
R2895:Smg1 UTSW 7 118189143 utr 3 prime probably benign
R2915:Smg1 UTSW 7 118210879 splice site probably benign
R3416:Smg1 UTSW 7 118148853 utr 3 prime probably benign
R3417:Smg1 UTSW 7 118148853 utr 3 prime probably benign
R3873:Smg1 UTSW 7 118154662 utr 3 prime probably benign
R4082:Smg1 UTSW 7 118160246 utr 3 prime probably benign
R4230:Smg1 UTSW 7 118148733 critical splice donor site probably null
R4304:Smg1 UTSW 7 118139518 missense probably benign 0.03
R4549:Smg1 UTSW 7 118159683 utr 3 prime probably benign
R4571:Smg1 UTSW 7 118139465 missense possibly damaging 0.72
R4638:Smg1 UTSW 7 118195926 utr 3 prime probably benign
R4642:Smg1 UTSW 7 118154264 utr 3 prime probably benign
R4656:Smg1 UTSW 7 118212951 missense probably benign 0.00
R4754:Smg1 UTSW 7 118156731 utr 3 prime probably benign
R4798:Smg1 UTSW 7 118180474 missense probably benign 0.32
R4906:Smg1 UTSW 7 118152408 utr 3 prime probably benign
R4978:Smg1 UTSW 7 118154247 utr 3 prime probably benign
R4989:Smg1 UTSW 7 118158100 utr 3 prime probably benign
R4989:Smg1 UTSW 7 118208051 missense probably benign
R5026:Smg1 UTSW 7 118193545 utr 3 prime probably benign
R5124:Smg1 UTSW 7 118213012 missense probably benign 0.00
R5318:Smg1 UTSW 7 118160204 utr 3 prime probably benign
R5356:Smg1 UTSW 7 118195133 utr 3 prime probably benign
R5404:Smg1 UTSW 7 118206908 missense probably damaging 1.00
R5423:Smg1 UTSW 7 118146071 missense possibly damaging 0.70
R5441:Smg1 UTSW 7 118195081 utr 3 prime probably benign
R5490:Smg1 UTSW 7 118139436 missense possibly damaging 0.86
R5541:Smg1 UTSW 7 118157163 utr 3 prime probably benign
R5564:Smg1 UTSW 7 118189819 utr 3 prime probably benign
R5580:Smg1 UTSW 7 118148902 utr 3 prime probably benign
R5600:Smg1 UTSW 7 118167884 utr 3 prime probably benign
R5628:Smg1 UTSW 7 118154701 utr 3 prime probably benign
R5646:Smg1 UTSW 7 118212559 missense probably benign 0.42
R5656:Smg1 UTSW 7 118154664 utr 3 prime probably benign
R5660:Smg1 UTSW 7 118143347 missense probably benign 0.33
R5706:Smg1 UTSW 7 118145590 missense possibly damaging 0.86
R5786:Smg1 UTSW 7 118212897 missense probably benign 0.12
R5890:Smg1 UTSW 7 118190586 utr 3 prime probably benign
R5912:Smg1 UTSW 7 118154586 utr 3 prime probably benign
R5977:Smg1 UTSW 7 118141357 utr 3 prime probably benign
R5993:Smg1 UTSW 7 118140509 missense probably benign 0.33
R6161:Smg1 UTSW 7 118163330 utr 3 prime probably benign
R6187:Smg1 UTSW 7 118189163 utr 3 prime probably benign
R6264:Smg1 UTSW 7 118166087 utr 3 prime probably benign
R6331:Smg1 UTSW 7 118154277 utr 3 prime probably benign
R6561:Smg1 UTSW 7 118166077 utr 3 prime probably benign
R6571:Smg1 UTSW 7 118184514 utr 3 prime probably benign
R6736:Smg1 UTSW 7 118157166 utr 3 prime probably benign
R6752:Smg1 UTSW 7 118163316 utr 3 prime probably benign
R6777:Smg1 UTSW 7 118189117 utr 3 prime probably benign
R6788:Smg1 UTSW 7 118184571 utr 3 prime probably benign
R6883:Smg1 UTSW 7 118168180 utr 3 prime probably benign
R6991:Smg1 UTSW 7 118167868 utr 3 prime probably benign
R7056:Smg1 UTSW 7 118146400 splice site probably benign
R7058:Smg1 UTSW 7 118198279 utr 3 prime probably benign
R7100:Smg1 UTSW 7 118184520 missense unknown
R7133:Smg1 UTSW 7 118152908 missense unknown
R7221:Smg1 UTSW 7 118182797 missense possibly damaging 0.86
R7229:Smg1 UTSW 7 118176955 missense probably benign 0.03
R7293:Smg1 UTSW 7 118166099 missense unknown
R7361:Smg1 UTSW 7 118184977 missense unknown
R7438:Smg1 UTSW 7 118195893 missense unknown
R7686:Smg1 UTSW 7 118167858 missense unknown
R7798:Smg1 UTSW 7 118171939 missense possibly damaging 0.73
R7908:Smg1 UTSW 7 118186134 missense unknown
R7923:Smg1 UTSW 7 118143322 missense possibly damaging 0.96
R7978:Smg1 UTSW 7 118193655 missense unknown
R7997:Smg1 UTSW 7 118173141 missense unknown
R7997:Smg1 UTSW 7 118173142 missense unknown
R8025:Smg1 UTSW 7 118206989 nonsense probably null
R8056:Smg1 UTSW 7 118160366 missense unknown
R8061:Smg1 UTSW 7 118152387 missense unknown
R8095:Smg1 UTSW 7 118173062 missense unknown
R8198:Smg1 UTSW 7 118145606 missense probably benign 0.03
R8399:Smg1 UTSW 7 118190571 missense unknown
R8445:Smg1 UTSW 7 118136977 missense possibly damaging 0.72
R8519:Smg1 UTSW 7 118171759 utr 3 prime probably benign
R8817:Smg1 UTSW 7 118159664 missense unknown
R8832:Smg1 UTSW 7 118139783 missense probably benign 0.33
R8855:Smg1 UTSW 7 118206899 missense unknown
R8866:Smg1 UTSW 7 118206899 missense unknown
R8946:Smg1 UTSW 7 118152677 missense probably null
R8954:Smg1 UTSW 7 118206992 missense probably damaging 1.00
R8967:Smg1 UTSW 7 118166516 missense unknown
R9072:Smg1 UTSW 7 118183809 missense unknown
R9090:Smg1 UTSW 7 118212563 missense unknown
R9156:Smg1 UTSW 7 118154661 missense unknown
R9198:Smg1 UTSW 7 118195956 missense unknown
R9240:Smg1 UTSW 7 118139808 missense probably benign 0.18
R9271:Smg1 UTSW 7 118212563 missense unknown
R9289:Smg1 UTSW 7 118145416 missense possibly damaging 0.53
R9378:Smg1 UTSW 7 118178775 nonsense probably null
R9396:Smg1 UTSW 7 118208080 missense unknown
R9469:Smg1 UTSW 7 118140551 missense possibly damaging 0.72
R9539:Smg1 UTSW 7 118145753 missense probably benign 0.03
R9549:Smg1 UTSW 7 118196031 missense unknown
R9563:Smg1 UTSW 7 118212985 missense unknown
R9564:Smg1 UTSW 7 118212985 missense unknown
R9597:Smg1 UTSW 7 118213047 missense unknown
Z1088:Smg1 UTSW 7 118154635 utr 3 prime probably benign
Z1088:Smg1 UTSW 7 118168661 nonsense probably null
Z1088:Smg1 UTSW 7 118178399 missense possibly damaging 0.96
Z1176:Smg1 UTSW 7 118206887 missense unknown
Z1176:Smg1 UTSW 7 118206907 missense unknown
Z1177:Smg1 UTSW 7 118168608 missense probably null
Z1177:Smg1 UTSW 7 118213033 missense unknown
Predicted Primers PCR Primer
(F):5'- GCAGGGTAGCCATCACTATCACATC -3'
(R):5'- ATGTCGGCCAGCAGGAATTCAG -3'

Sequencing Primer
(F):5'- ATTCCCTTAGAAGACGGTGC -3'
(R):5'- GTGCCAAGATTCCTGTTACAAC -3'
Posted On 2013-04-24