Mutagenetix > Incidental Mutations

Incidental Mutation 'R5817:Map1a'

449076

Institutional Source

Beutler Lab

Gene Symbol

Map1a

Ensembl Gene

ENSMUSG00000027254

Gene Name

microtubule-associated protein 1 A

Synonyms

Mtap1, Mtap-1, 6330416M19Rik, Mtap1a

MMRRC Submission

043397-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.367) question?

Stock #

R5817 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

121289600-121310832 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 121298910 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 143 (H143L)

Ref Sequence

ENSEMBL: ENSMUSP00000092223 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094639] [ENSMUST00000110639]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000094639
AA Change: H143L

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000092223
Gene: ENSMUSG00000027254
AA Change: H143L

Domain	Start	End	E-Value	Type
Blast:Lactamase_B	286	538	2e-54	BLAST
SCOP:d1eq1a_	584	699	8e-5	SMART
low complexity region	743	755	N/A	INTRINSIC
low complexity region	820	833	N/A	INTRINSIC
low complexity region	852	867	N/A	INTRINSIC
low complexity region	897	911	N/A	INTRINSIC
low complexity region	1228	1239	N/A	INTRINSIC
low complexity region	1334	1344	N/A	INTRINSIC
low complexity region	1540	1555	N/A	INTRINSIC
coiled coil region	1573	1602	N/A	INTRINSIC
internal_repeat_1	1616	1726	7.66e-6	PROSPERO
coiled coil region	1747	1771	N/A	INTRINSIC
internal_repeat_1	1774	1888	7.66e-6	PROSPERO
low complexity region	2060	2084	N/A	INTRINSIC
low complexity region	2121	2133	N/A	INTRINSIC
low complexity region	2156	2169	N/A	INTRINSIC
low complexity region	2383	2396	N/A	INTRINSIC
low complexity region	2436	2460	N/A	INTRINSIC
low complexity region	2517	2541	N/A	INTRINSIC
low complexity region	2589	2600	N/A	INTRINSIC
low complexity region	2662	2682	N/A	INTRINSIC
low complexity region	2685	2704	N/A	INTRINSIC
low complexity region	2716	2728	N/A	INTRINSIC
low complexity region	2766	2790	N/A	INTRINSIC
low complexity region	2980	2988	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110639

SMART Domains

Protein: ENSMUSP00000106269
Gene: ENSMUSG00000027254

Domain	Start	End	E-Value	Type
Blast:Lactamase_B	48	300	3e-54	BLAST
SCOP:d1eq1a_	346	461	1e-4	SMART
low complexity region	505	517	N/A	INTRINSIC
low complexity region	582	595	N/A	INTRINSIC
low complexity region	614	629	N/A	INTRINSIC
low complexity region	659	673	N/A	INTRINSIC
low complexity region	990	1001	N/A	INTRINSIC
low complexity region	1096	1106	N/A	INTRINSIC
low complexity region	1302	1317	N/A	INTRINSIC
coiled coil region	1335	1364	N/A	INTRINSIC
internal_repeat_1	1378	1488	5.43e-6	PROSPERO
coiled coil region	1509	1533	N/A	INTRINSIC
internal_repeat_1	1536	1650	5.43e-6	PROSPERO
low complexity region	1822	1846	N/A	INTRINSIC
low complexity region	1883	1895	N/A	INTRINSIC
low complexity region	1918	1931	N/A	INTRINSIC
low complexity region	2145	2158	N/A	INTRINSIC
low complexity region	2198	2222	N/A	INTRINSIC
low complexity region	2279	2303	N/A	INTRINSIC
low complexity region	2351	2362	N/A	INTRINSIC
low complexity region	2424	2444	N/A	INTRINSIC
low complexity region	2447	2466	N/A	INTRINSIC
low complexity region	2478	2490	N/A	INTRINSIC
low complexity region	2528	2552	N/A	INTRINSIC
low complexity region	2742	2750	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129000

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133283

Meta Mutation Damage Score

0.1812

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.8%

Validation Efficiency

100% (71/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The product of this gene is a precursor polypeptide that presumably undergoes proteolytic processing to generate the final MAP1A heavy chain and LC2 light chain. Expression of this gene is almost exclusively in the brain. Studies of the rat microtubule-associated protein 1A gene suggested a role in early events of spinal cord development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit Purkinje cell degeneration. Mice homozygous for a spontaneous mutation exhibit mild ataxia and Purkinje cell degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadacl4	A	G	4: 144,622,927	I251M	probably benign	Het
Abcf3	T	C	16: 20,549,083	V63A	possibly damaging	Het
Agpat4	C	T	17: 12,215,210		probably benign	Het
Ahcyl2	G	A	6: 29,890,721	V292M	probably damaging	Het
Ahnak2	A	T	12: 112,774,003	F406I	probably damaging	Het
Aqp7	G	A	4: 41,035,510	T115I	probably benign	Het
Arhgef5	G	A	6: 43,275,104	D930N	probably benign	Het
Casc4	T	A	2: 121,906,044	S231T	probably benign	Het
Cc2d2a	G	A	5: 43,712,418	R887Q	probably damaging	Het
Ceacam18	A	G	7: 43,641,841	T236A	probably benign	Het
Chst15	A	T	7: 132,269,144	Y221N	probably damaging	Het
Chst15	G	A	7: 132,269,147	L220F	probably damaging	Het
Cntn2	G	A	1: 132,518,748	T784I	probably benign	Het
D630003M21Rik	A	G	2: 158,196,493	L1011P	probably damaging	Het
Dync2h1	T	A	9: 6,996,905	D3894V	probably damaging	Het
E330017A01Rik	T	C	16: 58,636,793	I89V	probably benign	Het
Fam13b	T	C	18: 34,457,797	M443V	possibly damaging	Het
Fam20a	T	A	11: 109,673,418	Q503L	possibly damaging	Het
Gm11677	C	T	11: 111,724,711		noncoding transcript	Het
Gm21319	G	T	12: 87,773,431	D119E	probably benign	Het
Gm5454	T	A	13: 103,356,632		noncoding transcript	Het
Gm5581	A	G	6: 131,167,169		noncoding transcript	Het
Gm6619	A	G	6: 131,486,437	I6V	unknown	Het
Gmcl1	A	G	6: 86,714,248	M255T	probably damaging	Het
Gprc5c	T	A	11: 114,863,624	C42*	probably null	Het
Hmcn1	T	A	1: 150,737,524	E1384V	possibly damaging	Het
Il6	A	G	5: 30,018,008	I91V	probably benign	Het
Kmt2d	A	T	15: 98,862,363	S1005T	unknown	Het
Mical2	A	T	7: 112,323,659	T624S	probably benign	Het
Msh3	A	T	13: 92,286,000	N549K	possibly damaging	Het
Ncr1	T	A	7: 4,340,895	I164N	possibly damaging	Het
Olfr1333	T	G	4: 118,830,099	T115P	probably damaging	Het
Olfr554	A	G	7: 102,640,378	N44S	probably damaging	Het
Olfr586	A	T	7: 103,121,908	M292K	possibly damaging	Het
Olfr926	A	G	9: 38,877,377	D67G	probably damaging	Het
Palmd	T	C	3: 116,918,623	I541M	probably benign	Het
Pcsk7	A	T	9: 45,926,033	M552L	probably benign	Het
Plekhh2	A	G	17: 84,571,726	E626G	possibly damaging	Het
Pole	G	A	5: 110,312,972	D1176N	probably damaging	Het
Polr2f	T	C	15: 79,151,669	I110T	probably damaging	Het
Pomt1	A	T	2: 32,248,679	I436F	probably damaging	Het
Prag1	A	C	8: 36,103,703	Q480P	probably damaging	Het
Qars	C	T	9: 108,510,242		probably benign	Het
Ralgapa2	G	A	2: 146,333,486	S1797L	probably damaging	Het
Rbm26	T	C	14: 105,128,603	T832A	probably damaging	Het
Rnf169	A	G	7: 99,925,769	S540P	probably benign	Het
Serpini1	T	A	3: 75,613,324	M76K	probably benign	Het
Shq1	A	G	6: 100,573,720	L419S	probably damaging	Het
Slc25a17	G	A	15: 81,327,060	T225M	probably damaging	Het
Slc6a5	C	A	7: 49,956,491	L716I	probably benign	Het
Smc1b	A	G	15: 85,067,783	V1149A	probably damaging	Het
Trappc1	A	T	11: 69,324,234	Q26L	possibly damaging	Het
Trpm2	C	A	10: 77,965,980	G84W	probably damaging	Het
Ttn	G	A	2: 76,742,666	T24215M	probably damaging	Het
Ubn2	C	A	6: 38,479,153	T337K	probably damaging	Het
Ubr4	A	G	4: 139,468,847	K1265E	probably damaging	Het
Vmn1r214	T	G	13: 23,035,321	I328M	probably damaging	Het
Xcr1	C	T	9: 123,855,857	C280Y	possibly damaging	Het
Zc3h13	A	G	14: 75,328,132	E895G	probably damaging	Het

Other mutations in Map1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00419:Map1a	APN	2	121299027	missense	probably damaging	0.99
IGL00826:Map1a	APN	2	121302276	missense	possibly damaging	0.87
IGL01476:Map1a	APN	2	121305207	missense	probably damaging	1.00
IGL02029:Map1a	APN	2	121303298	missense	possibly damaging	0.57
IGL02100:Map1a	APN	2	121302846	missense	probably damaging	0.99
IGL02136:Map1a	APN	2	121300212	missense	probably damaging	1.00
IGL02146:Map1a	APN	2	121299446	missense	probably damaging	1.00
IGL02264:Map1a	APN	2	121307313	missense	probably damaging	1.00
IGL02456:Map1a	APN	2	121298653	missense	probably damaging	1.00
IGL02485:Map1a	APN	2	121299288	missense	probably damaging	1.00
IGL02535:Map1a	APN	2	121302177	nonsense	probably null
IGL02628:Map1a	APN	2	121300104	missense	probably damaging	1.00
IGL02721:Map1a	APN	2	121304037	missense	probably benign	0.44
IGL03273:Map1a	APN	2	121300238	missense	probably damaging	1.00
IGL03281:Map1a	APN	2	121305060	missense	probably damaging	1.00
IGL02991:Map1a	UTSW	2	121301610	missense	probably damaging	0.99
R0096:Map1a	UTSW	2	121301505	missense	probably damaging	1.00
R0096:Map1a	UTSW	2	121301505	missense	probably damaging	1.00
R0218:Map1a	UTSW	2	121305425	missense	probably benign	0.00
R0363:Map1a	UTSW	2	121302044	missense	probably damaging	1.00
R0450:Map1a	UTSW	2	121305774	missense	probably benign	0.27
R0469:Map1a	UTSW	2	121305774	missense	probably benign	0.27
R0477:Map1a	UTSW	2	121302101	missense	probably damaging	1.00
R0504:Map1a	UTSW	2	121302941	missense	probably benign	0.03
R0510:Map1a	UTSW	2	121305774	missense	probably benign	0.27
R0521:Map1a	UTSW	2	121305753	missense	probably damaging	1.00
R0601:Map1a	UTSW	2	121298602	missense	probably damaging	1.00
R0619:Map1a	UTSW	2	121305255	missense	probably damaging	0.96
R0633:Map1a	UTSW	2	121308014	missense	probably damaging	1.00
R0652:Map1a	UTSW	2	121302783	missense	probably benign	0.04
R0893:Map1a	UTSW	2	121300533	missense	probably damaging	1.00
R0960:Map1a	UTSW	2	121301643	missense	probably benign	0.16
R1115:Map1a	UTSW	2	121307378	splice site	probably null
R1166:Map1a	UTSW	2	121300260	missense	probably damaging	1.00
R1326:Map1a	UTSW	2	121306190	nonsense	probably null
R1331:Map1a	UTSW	2	121306220	nonsense	probably null
R1395:Map1a	UTSW	2	121303925	missense	probably benign	0.26
R1489:Map1a	UTSW	2	121300437	missense	possibly damaging	0.91
R1573:Map1a	UTSW	2	121304126	missense	probably benign	0.37
R1596:Map1a	UTSW	2	121289765	missense	probably benign	0.00
R1662:Map1a	UTSW	2	121306408	missense	possibly damaging	0.90
R1675:Map1a	UTSW	2	121302655	nonsense	probably null
R1919:Map1a	UTSW	2	121307012	missense	probably damaging	1.00
R2122:Map1a	UTSW	2	121299446	missense	probably damaging	1.00
R2126:Map1a	UTSW	2	121298641	missense	probably damaging	0.96
R2143:Map1a	UTSW	2	121301945	missense	probably damaging	1.00
R2172:Map1a	UTSW	2	121307932	missense	probably damaging	1.00
R2249:Map1a	UTSW	2	121300287	missense	probably damaging	1.00
R2254:Map1a	UTSW	2	121303791	missense	possibly damaging	0.71
R2255:Map1a	UTSW	2	121303791	missense	possibly damaging	0.71
R3834:Map1a	UTSW	2	121307322	missense	probably damaging	1.00
R4011:Map1a	UTSW	2	121300127	missense	probably damaging	1.00
R4346:Map1a	UTSW	2	121301325	missense	probably benign	0.13
R4842:Map1a	UTSW	2	121302086	missense	probably damaging	1.00
R4933:Map1a	UTSW	2	121305905	missense	probably damaging	1.00
R4978:Map1a	UTSW	2	121301142	missense	probably benign	0.00
R4988:Map1a	UTSW	2	121303050	missense	probably benign	0.34
R5026:Map1a	UTSW	2	121307538	missense	possibly damaging	0.83
R5086:Map1a	UTSW	2	121304504	missense	probably damaging	1.00
R5155:Map1a	UTSW	2	121302386	missense	probably damaging	1.00
R5232:Map1a	UTSW	2	121301985	missense	probably damaging	1.00
R5311:Map1a	UTSW	2	121302387	missense	probably damaging	1.00
R5401:Map1a	UTSW	2	121299672	missense	probably damaging	1.00
R5465:Map1a	UTSW	2	121306025	missense	probably damaging	1.00
R5526:Map1a	UTSW	2	121305662	missense	probably damaging	1.00
R5642:Map1a	UTSW	2	121306043	missense	probably damaging	1.00
R5726:Map1a	UTSW	2	121305065	missense	probably damaging	1.00
R5855:Map1a	UTSW	2	121303674	missense	possibly damaging	0.74
R5917:Map1a	UTSW	2	121305216	missense	probably damaging	1.00
R5974:Map1a	UTSW	2	121304376	missense	probably benign	0.20
R5987:Map1a	UTSW	2	121304295	missense	possibly damaging	0.56
R6151:Map1a	UTSW	2	121289823	missense	probably benign	0.12
R6406:Map1a	UTSW	2	121300743	missense	probably damaging	1.00
R7014:Map1a	UTSW	2	121300239	missense	probably damaging	1.00
R7099:Map1a	UTSW	2	121300517	missense	probably benign	0.04
R7211:Map1a	UTSW	2	121304643	missense	probably benign	0.02
R7230:Map1a	UTSW	2	121300818	missense	probably damaging	1.00
R7305:Map1a	UTSW	2	121299458	missense	probably damaging	1.00
R7382:Map1a	UTSW	2	121290785	missense	probably damaging	1.00
R7524:Map1a	UTSW	2	121289812	missense	probably damaging	1.00
R7699:Map1a	UTSW	2	121299720	missense	probably damaging	1.00
R7767:Map1a	UTSW	2	121302036	missense	probably damaging	1.00
R7883:Map1a	UTSW	2	121305372	missense	probably damaging	1.00
R7896:Map1a	UTSW	2	121305176	missense	probably benign	0.00
R7993:Map1a	UTSW	2	121304576	missense	possibly damaging	0.84
R8270:Map1a	UTSW	2	121299020	missense	probably damaging	0.99
R8365:Map1a	UTSW	2	121308047	missense	probably damaging	1.00
R8428:Map1a	UTSW	2	121304937	missense	probably benign	0.42
R8490:Map1a	UTSW	2	121304564	missense	possibly damaging	0.93
R8678:Map1a	UTSW	2	121307256	missense	probably damaging	1.00
R8798:Map1a	UTSW	2	121302287	missense	probably benign	0.20
R8857:Map1a	UTSW	2	121307617	missense	probably damaging	1.00
R8878:Map1a	UTSW	2	121307644	missense	probably damaging	1.00
R8909:Map1a	UTSW	2	121298910	missense	probably damaging	0.99
R8917:Map1a	UTSW	2	121301310	missense	possibly damaging	0.93
R8947:Map1a	UTSW	2	121304969	missense	probably benign	0.27
R9069:Map1a	UTSW	2	121303664	missense	probably benign	0.15
R9198:Map1a	UTSW	2	121303373	missense	probably benign	0.00
R9253:Map1a	UTSW	2	121302342	missense	probably benign	0.00
R9290:Map1a	UTSW	2	121300533	missense	probably damaging	1.00
R9300:Map1a	UTSW	2	121302965	missense	probably damaging	1.00
RF003:Map1a	UTSW	2	121306296	small insertion	probably benign
RF007:Map1a	UTSW	2	121306308	small insertion	probably benign
RF009:Map1a	UTSW	2	121306301	small insertion	probably benign
RF010:Map1a	UTSW	2	121306318	small insertion	probably benign
RF014:Map1a	UTSW	2	121306295	small insertion	probably benign
RF017:Map1a	UTSW	2	121306308	small insertion	probably benign
RF024:Map1a	UTSW	2	121306307	small insertion	probably benign
RF025:Map1a	UTSW	2	121306294	small insertion	probably benign
RF030:Map1a	UTSW	2	121306311	small insertion	probably benign
RF030:Map1a	UTSW	2	121306317	small insertion	probably benign
RF033:Map1a	UTSW	2	121306299	small insertion	probably benign
RF034:Map1a	UTSW	2	121306304	small insertion	probably benign
RF034:Map1a	UTSW	2	121306307	small insertion	probably benign
RF035:Map1a	UTSW	2	121306301	small insertion	probably benign
RF037:Map1a	UTSW	2	121306294	small insertion	probably benign
RF039:Map1a	UTSW	2	121306304	small insertion	probably benign
RF042:Map1a	UTSW	2	121306287	small insertion	probably benign
RF044:Map1a	UTSW	2	121306293	small insertion	probably benign
RF045:Map1a	UTSW	2	121306293	small insertion	probably benign
RF051:Map1a	UTSW	2	121306296	small insertion	probably benign
RF052:Map1a	UTSW	2	121306295	small insertion	probably benign
RF053:Map1a	UTSW	2	121306290	small insertion	probably benign
RF060:Map1a	UTSW	2	121306318	small insertion	probably benign
RF061:Map1a	UTSW	2	121306287	small insertion	probably benign
Z1176:Map1a	UTSW	2	121303238	missense	possibly damaging	0.95
Z1177:Map1a	UTSW	2	121305279	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CTTGTTCTGAGTGCTATAACCGAC -3'
(R):5'- ACAACTTAAGTCCTGCCTCCTG -3'

Sequencing Primer
(F):5'- TGAGTGCTATAACCGACCCTTGG -3'
(R):5'- GTCCCCTTCTTCCAAGACACG -3'

Posted On

2016-12-20