Incidental Mutation 'R5698:Nol9'
ID450776
Institutional Source Beutler Lab
Gene Symbol Nol9
Ensembl Gene ENSMUSG00000028948
Gene Namenucleolar protein 9
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R5698 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location152039321-152061494 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 152050574 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 388 (V388A)
Ref Sequence ENSEMBL: ENSMUSP00000099486 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084116] [ENSMUST00000103197]
Predicted Effect probably damaging
Transcript: ENSMUST00000084116
AA Change: V388A

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000081133
Gene: ENSMUSG00000028948
AA Change: V388A

DomainStartEndE-ValueType
low complexity region 24 42 N/A INTRINSIC
low complexity region 45 54 N/A INTRINSIC
low complexity region 79 106 N/A INTRINSIC
low complexity region 281 294 N/A INTRINSIC
Pfam:CLP1_P 322 480 7.5e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000103197
AA Change: V388A

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099486
Gene: ENSMUSG00000028948
AA Change: V388A

DomainStartEndE-ValueType
low complexity region 24 42 N/A INTRINSIC
low complexity region 45 54 N/A INTRINSIC
low complexity region 79 106 N/A INTRINSIC
low complexity region 281 294 N/A INTRINSIC
Pfam:MobB 316 429 5.9e-18 PFAM
Pfam:Clp1 425 665 1.9e-67 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105663
SMART Domains Protein: ENSMUSP00000101288
Gene: ENSMUSG00000028948

DomainStartEndE-ValueType
low complexity region 24 42 N/A INTRINSIC
low complexity region 45 54 N/A INTRINSIC
low complexity region 79 106 N/A INTRINSIC
low complexity region 281 294 N/A INTRINSIC
Pfam:MobB 316 429 5.3e-18 PFAM
Pfam:Clp1 425 627 5.8e-46 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000131696
AA Change: C356R
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147797
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik A G 11: 3,976,366 K334E possibly damaging Het
Ache G A 5: 137,290,559 V176M probably damaging Het
Acss3 T C 10: 106,948,744 D539G probably damaging Het
Adam6b T A 12: 113,491,463 D633E probably benign Het
Aldh16a1 G A 7: 45,154,407 probably benign Het
Amigo2 G A 15: 97,245,726 Q272* probably null Het
Appbp2 A T 11: 85,210,099 H171Q probably damaging Het
Arhgef18 A G 8: 3,439,499 D277G probably damaging Het
Armc8 A G 9: 99,535,820 V95A probably benign Het
Atp6v0a4 C T 6: 38,050,507 probably null Het
Atp8a1 A T 5: 67,767,153 N289K probably benign Het
Cand2 C T 6: 115,791,743 L505F probably damaging Het
Ccnt2 A G 1: 127,803,228 K614R probably benign Het
Col25a1 A G 3: 130,478,983 probably null Het
Copa T A 1: 172,118,944 L976* probably null Het
Ddx39b T C 17: 35,251,311 V267A probably benign Het
Doxl2 A G 6: 48,976,322 T394A possibly damaging Het
Dpp4 T A 2: 62,334,311 Q709L probably damaging Het
Eno4 A G 19: 58,968,472 probably null Het
Exoc3 A G 13: 74,174,015 L647P probably benign Het
Eya4 T C 10: 23,140,077 S308G possibly damaging Het
Fbxo41 T C 6: 85,477,656 T693A possibly damaging Het
Fcgbp A G 7: 28,092,022 T903A possibly damaging Het
Fkbp10 G T 11: 100,423,526 W384L probably damaging Het
Frem2 A G 3: 53,652,505 I1527T possibly damaging Het
Gm14124 C T 2: 150,269,474 H695Y possibly damaging Het
H13 T A 2: 152,688,955 I220N probably damaging Het
Has2 T C 15: 56,667,916 R468G probably damaging Het
Ighmbp2 A G 19: 3,274,538 S243P probably damaging Het
Irs1 T C 1: 82,288,734 H587R probably benign Het
Kcnk1 C T 8: 126,025,405 T250M probably damaging Het
Kif9 T C 9: 110,510,464 V458A probably benign Het
Krt14 T C 11: 100,205,625 T208A probably benign Het
Mybpc3 C A 2: 91,124,849 H349Q possibly damaging Het
Neurl3 T A 1: 36,266,506 T207S possibly damaging Het
Notch3 T C 17: 32,157,987 N315D probably damaging Het
Oas1h G T 5: 120,870,982 A252S probably damaging Het
Olfr156 C A 4: 43,821,183 M59I probably damaging Het
Pcbp1 G A 6: 86,525,152 T255M possibly damaging Het
Plec A G 15: 76,199,608 V18A probably benign Het
Ppp1r17 A T 6: 56,026,544 E114V probably damaging Het
Scamp5 A T 9: 57,445,433 M151K possibly damaging Het
Sestd1 T C 2: 77,218,168 Y135C possibly damaging Het
Slc22a21 T G 11: 53,951,349 K534N probably benign Het
Slc25a12 T C 2: 71,282,573 E448G probably damaging Het
Slco3a1 A G 7: 74,346,818 L280P probably damaging Het
Sppl2b C A 10: 80,866,045 probably null Het
Srd5a2 T C 17: 74,027,019 E135G possibly damaging Het
Tfg A T 16: 56,701,104 M183K probably damaging Het
Ticrr G A 7: 79,679,133 M673I probably benign Het
Tm4sf20 T G 1: 82,768,237 M61L probably benign Het
Ttll8 A T 15: 88,939,006 S85T possibly damaging Het
Uggt2 G A 14: 119,042,726 S780F probably damaging Het
Uroc1 T C 6: 90,347,320 L442P probably damaging Het
Znrf3 A G 11: 5,289,006 probably benign Het
Zswim2 C A 2: 83,925,183 D125Y possibly damaging Het
Other mutations in Nol9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00770:Nol9 APN 4 152052015 missense probably benign 0.38
IGL00774:Nol9 APN 4 152052015 missense probably benign 0.38
IGL00885:Nol9 APN 4 152041600 missense probably damaging 1.00
IGL01125:Nol9 APN 4 152046609 missense probably damaging 1.00
IGL01368:Nol9 APN 4 152058391 missense probably benign
IGL01759:Nol9 APN 4 152046043 intron probably benign
IGL01983:Nol9 APN 4 152046037 critical splice donor site probably null
IGL02185:Nol9 APN 4 152057911 missense probably damaging 1.00
IGL02869:Nol9 APN 4 152046573 missense probably damaging 1.00
IGL02967:Nol9 APN 4 152041102 missense possibly damaging 0.95
R0401:Nol9 UTSW 4 152052605 missense probably benign 0.00
R3721:Nol9 UTSW 4 152039706 missense probably benign 0.07
R4429:Nol9 UTSW 4 152041174 missense probably damaging 1.00
R4460:Nol9 UTSW 4 152057836 missense probably damaging 1.00
R4837:Nol9 UTSW 4 152052095 intron probably benign
R5137:Nol9 UTSW 4 152045971 missense probably damaging 1.00
R6190:Nol9 UTSW 4 152041234 missense possibly damaging 0.85
R6317:Nol9 UTSW 4 152041057 missense probably damaging 1.00
R6372:Nol9 UTSW 4 152045995 missense probably damaging 1.00
R6525:Nol9 UTSW 4 152039449 missense probably damaging 0.98
R6551:Nol9 UTSW 4 152051868 missense possibly damaging 0.80
R6580:Nol9 UTSW 4 152051761 missense probably benign 0.00
R7538:Nol9 UTSW 4 152039658 missense probably benign 0.05
R8143:Nol9 UTSW 4 152041102 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CACAGCTACTTTTGCTTGGCAG -3'
(R):5'- ACCCCATGTCATCGTGTGTG -3'

Sequencing Primer
(F):5'- TTTAATCCCAGCACTTGAGAGGC -3'
(R):5'- GGGTGCAGTGCTCATGGC -3'
Posted On2017-01-03