Incidental Mutation 'R5907:Ank1'
ID460715
Institutional Source Beutler Lab
Gene Symbol Ank1
Ensembl Gene ENSMUSG00000031543
Gene Nameankyrin 1, erythroid
SynonymsAnk-1, pale
MMRRC Submission 044104-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.530) question?
Stock #R5907 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location22974844-23150497 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 23140204 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 93 (E93D)
Ref Sequence ENSEMBL: ENSMUSP00000112966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033947] [ENSMUST00000084038] [ENSMUST00000110688] [ENSMUST00000117270] [ENSMUST00000117296] [ENSMUST00000117662] [ENSMUST00000118733] [ENSMUST00000121075] [ENSMUST00000121802] [ENSMUST00000123418] [ENSMUST00000141784] [ENSMUST00000173248] [ENSMUST00000173573] [ENSMUST00000174435]
Predicted Effect probably damaging
Transcript: ENSMUST00000033947
AA Change: E93D

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000033947
Gene: ENSMUSG00000031543
AA Change: E93D

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000084038
AA Change: E1786D

PolyPhen 2 Score 0.539 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000081051
Gene: ENSMUSG00000031543
AA Change: E1786D

DomainStartEndE-ValueType
ANK 15 44 2.5e3 SMART
ANK 48 77 3.26e0 SMART
ANK 81 110 3.15e-7 SMART
ANK 114 143 9.05e-8 SMART
ANK 147 175 4.67e-1 SMART
ANK 176 205 1.42e0 SMART
ANK 209 238 4.39e-6 SMART
ANK 242 271 1.33e-5 SMART
ANK 275 304 7.53e-5 SMART
ANK 308 337 2.35e-6 SMART
ANK 341 370 6.65e-6 SMART
ANK 374 403 5.2e-8 SMART
ANK 407 436 8.78e-6 SMART
ANK 440 469 7.53e-5 SMART
ANK 473 502 5.49e-7 SMART
ANK 506 535 2.58e-3 SMART
ANK 539 568 1.88e-5 SMART
ANK 572 601 1.02e-6 SMART
ANK 605 634 7.64e-6 SMART
ANK 638 669 3.23e-4 SMART
ANK 671 700 1.38e-3 SMART
ANK 704 733 1.58e-7 SMART
ANK 737 766 2.85e-5 SMART
ZU5 923 1027 1.9e-60 SMART
low complexity region 1050 1059 N/A INTRINSIC
low complexity region 1387 1397 N/A INTRINSIC
DEATH 1405 1499 3.21e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000093576
Predicted Effect probably benign
Transcript: ENSMUST00000110688
AA Change: E1682D

PolyPhen 2 Score 0.174 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000106316
Gene: ENSMUSG00000031543
AA Change: E1682D

DomainStartEndE-ValueType
coiled coil region 1 39 N/A INTRINSIC
ANK 44 73 2.5e3 SMART
ANK 77 106 3.26e0 SMART
ANK 110 139 3.15e-7 SMART
ANK 143 172 9.05e-8 SMART
ANK 176 204 4.67e-1 SMART
ANK 205 234 1.42e0 SMART
ANK 238 267 4.39e-6 SMART
ANK 271 300 1.33e-5 SMART
ANK 304 333 7.53e-5 SMART
ANK 337 366 2.35e-6 SMART
ANK 370 399 6.65e-6 SMART
ANK 403 432 5.2e-8 SMART
ANK 436 465 8.78e-6 SMART
ANK 469 498 7.53e-5 SMART
ANK 502 531 5.49e-7 SMART
ANK 535 564 2.58e-3 SMART
ANK 568 597 1.88e-5 SMART
ANK 601 630 1.02e-6 SMART
ANK 634 663 7.64e-6 SMART
ANK 667 698 3.23e-4 SMART
ANK 700 729 1.38e-3 SMART
ANK 733 762 1.58e-7 SMART
ANK 766 795 2.85e-5 SMART
ZU5 944 1048 1.9e-60 SMART
low complexity region 1071 1080 N/A INTRINSIC
low complexity region 1408 1418 N/A INTRINSIC
DEATH 1426 1520 3.21e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117270
AA Change: E1845D

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000113495
Gene: ENSMUSG00000031543
AA Change: E1845D

DomainStartEndE-ValueType
coiled coil region 1 39 N/A INTRINSIC
ANK 44 73 2.5e3 SMART
ANK 77 106 3.26e0 SMART
ANK 110 139 3.15e-7 SMART
ANK 143 172 9.05e-8 SMART
ANK 176 204 4.67e-1 SMART
ANK 205 234 1.42e0 SMART
ANK 238 267 4.39e-6 SMART
ANK 271 300 1.33e-5 SMART
ANK 304 333 7.53e-5 SMART
ANK 337 366 2.35e-6 SMART
ANK 370 399 6.65e-6 SMART
ANK 403 432 5.2e-8 SMART
ANK 436 465 8.78e-6 SMART
ANK 469 498 7.53e-5 SMART
ANK 502 531 5.49e-7 SMART
ANK 535 564 2.58e-3 SMART
ANK 568 597 1.88e-5 SMART
ANK 601 630 1.02e-6 SMART
ANK 634 663 7.64e-6 SMART
ANK 667 698 3.23e-4 SMART
ANK 700 729 1.38e-3 SMART
ANK 733 762 1.58e-7 SMART
ANK 766 795 2.85e-5 SMART
ZU5 952 1056 1.9e-60 SMART
low complexity region 1079 1088 N/A INTRINSIC
low complexity region 1416 1426 N/A INTRINSIC
DEATH 1434 1528 3.21e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117296
AA Change: E1800D

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000113656
Gene: ENSMUSG00000031543
AA Change: E1800D

DomainStartEndE-ValueType
ANK 7 36 2.5e3 SMART
ANK 40 69 3.26e0 SMART
ANK 73 102 3.15e-7 SMART
ANK 106 135 9.05e-8 SMART
ANK 139 167 4.67e-1 SMART
ANK 168 197 1.42e0 SMART
ANK 201 230 4.39e-6 SMART
ANK 234 263 1.33e-5 SMART
ANK 267 296 7.53e-5 SMART
ANK 300 329 2.35e-6 SMART
ANK 333 362 6.65e-6 SMART
ANK 366 395 5.2e-8 SMART
ANK 399 428 8.78e-6 SMART
ANK 432 461 7.53e-5 SMART
ANK 465 494 5.49e-7 SMART
ANK 498 527 2.58e-3 SMART
ANK 531 560 1.88e-5 SMART
ANK 564 593 1.02e-6 SMART
ANK 597 626 7.64e-6 SMART
ANK 630 661 3.23e-4 SMART
ANK 663 692 1.38e-3 SMART
ANK 696 725 1.58e-7 SMART
ANK 729 758 2.85e-5 SMART
ZU5 907 1011 1.9e-60 SMART
low complexity region 1034 1043 N/A INTRINSIC
low complexity region 1371 1381 N/A INTRINSIC
DEATH 1389 1483 3.21e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117662
AA Change: E1800D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113531
Gene: ENSMUSG00000031543
AA Change: E1800D

DomainStartEndE-ValueType
ANK 7 36 2.5e3 SMART
ANK 40 69 3.26e0 SMART
ANK 73 102 3.15e-7 SMART
ANK 106 135 9.05e-8 SMART
ANK 139 167 4.67e-1 SMART
ANK 168 197 1.42e0 SMART
ANK 201 230 4.39e-6 SMART
ANK 234 263 1.33e-5 SMART
ANK 267 296 7.53e-5 SMART
ANK 300 329 2.35e-6 SMART
ANK 333 362 6.65e-6 SMART
ANK 366 395 5.2e-8 SMART
ANK 399 428 8.78e-6 SMART
ANK 432 461 7.53e-5 SMART
ANK 465 494 5.49e-7 SMART
ANK 498 527 2.58e-3 SMART
ANK 531 560 1.88e-5 SMART
ANK 564 593 1.02e-6 SMART
ANK 597 626 7.64e-6 SMART
ANK 630 661 3.23e-4 SMART
ANK 663 692 1.38e-3 SMART
ANK 696 725 1.58e-7 SMART
ANK 729 758 2.85e-5 SMART
ZU5 907 1011 1.9e-60 SMART
low complexity region 1034 1043 N/A INTRINSIC
low complexity region 1371 1381 N/A INTRINSIC
DEATH 1389 1483 3.21e-26 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000118733
AA Change: E1816D

PolyPhen 2 Score 0.539 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000112850
Gene: ENSMUSG00000031543
AA Change: E1816D

DomainStartEndE-ValueType
ANK 15 44 2.5e3 SMART
ANK 48 77 3.26e0 SMART
ANK 81 110 3.15e-7 SMART
ANK 114 143 9.05e-8 SMART
ANK 147 175 4.67e-1 SMART
ANK 176 205 1.42e0 SMART
ANK 209 238 4.39e-6 SMART
ANK 242 271 1.33e-5 SMART
ANK 275 304 7.53e-5 SMART
ANK 308 337 2.35e-6 SMART
ANK 341 370 6.65e-6 SMART
ANK 374 403 5.2e-8 SMART
ANK 407 436 8.78e-6 SMART
ANK 440 469 7.53e-5 SMART
ANK 473 502 5.49e-7 SMART
ANK 506 535 2.58e-3 SMART
ANK 539 568 1.88e-5 SMART
ANK 572 601 1.02e-6 SMART
ANK 605 634 7.64e-6 SMART
ANK 638 669 3.23e-4 SMART
ANK 671 700 1.38e-3 SMART
ANK 704 733 1.58e-7 SMART
ANK 737 766 2.85e-5 SMART
ZU5 923 1027 1.9e-60 SMART
low complexity region 1050 1059 N/A INTRINSIC
low complexity region 1387 1397 N/A INTRINSIC
DEATH 1405 1499 3.21e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121075
AA Change: E93D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112966
Gene: ENSMUSG00000031543
AA Change: E93D

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121802
AA Change: E1845D

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000113571
Gene: ENSMUSG00000031543
AA Change: E1845D

DomainStartEndE-ValueType
coiled coil region 1 39 N/A INTRINSIC
ANK 44 73 2.5e3 SMART
ANK 77 106 3.26e0 SMART
ANK 110 139 3.15e-7 SMART
ANK 143 172 9.05e-8 SMART
ANK 176 204 4.67e-1 SMART
ANK 205 234 1.42e0 SMART
ANK 238 267 4.39e-6 SMART
ANK 271 300 1.33e-5 SMART
ANK 304 333 7.53e-5 SMART
ANK 337 366 2.35e-6 SMART
ANK 370 399 6.65e-6 SMART
ANK 403 432 5.2e-8 SMART
ANK 436 465 8.78e-6 SMART
ANK 469 498 7.53e-5 SMART
ANK 502 531 5.49e-7 SMART
ANK 535 564 2.58e-3 SMART
ANK 568 597 1.88e-5 SMART
ANK 601 630 1.02e-6 SMART
ANK 634 663 7.64e-6 SMART
ANK 667 698 3.23e-4 SMART
ANK 700 729 1.38e-3 SMART
ANK 733 762 1.58e-7 SMART
ANK 766 795 2.85e-5 SMART
ZU5 952 1056 1.9e-60 SMART
low complexity region 1079 1088 N/A INTRINSIC
low complexity region 1416 1426 N/A INTRINSIC
DEATH 1434 1528 3.21e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123418
SMART Domains Protein: ENSMUSP00000121785
Gene: ENSMUSG00000031543

DomainStartEndE-ValueType
ANK 15 44 2.5e3 SMART
ANK 48 77 3.26e0 SMART
ANK 81 110 3.15e-7 SMART
ANK 114 143 9.05e-8 SMART
ANK 147 175 4.67e-1 SMART
ANK 176 205 1.42e0 SMART
ANK 209 238 4.39e-6 SMART
ANK 242 271 1.33e-5 SMART
ANK 275 304 7.53e-5 SMART
ANK 308 337 2.35e-6 SMART
ANK 341 370 6.65e-6 SMART
ANK 374 403 5.2e-8 SMART
ANK 407 436 8.78e-6 SMART
ANK 440 469 7.53e-5 SMART
ANK 473 502 5.49e-7 SMART
ANK 506 535 2.58e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130311
Predicted Effect probably benign
Transcript: ENSMUST00000141784
AA Change: E1800D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117966
Gene: ENSMUSG00000031543
AA Change: E1800D

DomainStartEndE-ValueType
ANK 7 36 2.5e3 SMART
ANK 40 69 3.26e0 SMART
ANK 73 102 3.15e-7 SMART
ANK 106 135 9.05e-8 SMART
ANK 139 167 4.67e-1 SMART
ANK 168 197 1.42e0 SMART
ANK 201 230 4.39e-6 SMART
ANK 234 263 1.33e-5 SMART
ANK 267 296 7.53e-5 SMART
ANK 300 329 2.35e-6 SMART
ANK 333 362 6.65e-6 SMART
ANK 366 395 5.2e-8 SMART
ANK 399 428 8.78e-6 SMART
ANK 432 461 7.53e-5 SMART
ANK 465 494 5.49e-7 SMART
ANK 498 527 2.58e-3 SMART
ANK 531 560 1.88e-5 SMART
ANK 564 593 1.02e-6 SMART
ANK 597 626 7.64e-6 SMART
ANK 630 661 3.23e-4 SMART
ANK 663 692 1.38e-3 SMART
ANK 696 725 1.58e-7 SMART
ANK 729 758 2.85e-5 SMART
ZU5 907 1011 1.9e-60 SMART
low complexity region 1034 1043 N/A INTRINSIC
low complexity region 1371 1381 N/A INTRINSIC
DEATH 1389 1483 3.21e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141930
Predicted Effect probably benign
Transcript: ENSMUST00000173248
AA Change: E1790D

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000133322
Gene: ENSMUSG00000031543
AA Change: E1790D

DomainStartEndE-ValueType
ANK 15 44 2.5e3 SMART
ANK 48 77 3.26e0 SMART
ANK 81 110 3.15e-7 SMART
ANK 114 143 9.05e-8 SMART
ANK 147 175 4.67e-1 SMART
ANK 176 205 1.42e0 SMART
ANK 209 238 4.39e-6 SMART
ANK 242 271 1.33e-5 SMART
ANK 275 304 7.53e-5 SMART
ANK 308 337 2.35e-6 SMART
ANK 341 370 6.65e-6 SMART
ANK 374 403 5.2e-8 SMART
ANK 407 436 8.78e-6 SMART
ANK 440 469 7.53e-5 SMART
ANK 473 502 5.49e-7 SMART
ANK 506 535 2.58e-3 SMART
ANK 539 568 1.88e-5 SMART
ANK 572 601 1.02e-6 SMART
ANK 605 634 7.64e-6 SMART
ANK 638 669 3.23e-4 SMART
ANK 671 700 1.38e-3 SMART
ANK 704 733 1.58e-7 SMART
ANK 737 766 2.85e-5 SMART
ZU5 923 1027 1.9e-60 SMART
low complexity region 1050 1059 N/A INTRINSIC
low complexity region 1387 1397 N/A INTRINSIC
DEATH 1405 1499 3.21e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173573
SMART Domains Protein: ENSMUSP00000133901
Gene: ENSMUSG00000031543

DomainStartEndE-ValueType
ANK 15 44 2.5e3 SMART
ANK 48 77 3.26e0 SMART
ANK 81 110 3.15e-7 SMART
ANK 114 143 9.05e-8 SMART
ANK 147 175 4.67e-1 SMART
ANK 176 205 1.42e0 SMART
ANK 209 238 4.39e-6 SMART
ANK 242 271 1.33e-5 SMART
ANK 275 304 7.53e-5 SMART
ANK 308 337 2.35e-6 SMART
ANK 341 370 6.65e-6 SMART
ANK 374 403 5.2e-8 SMART
ANK 407 436 8.78e-6 SMART
ANK 440 469 7.53e-5 SMART
ANK 473 502 5.49e-7 SMART
ANK 506 535 2.58e-3 SMART
ANK 539 568 1.88e-5 SMART
ANK 572 601 1.02e-6 SMART
ANK 605 634 7.64e-6 SMART
ANK 638 669 3.23e-4 SMART
ANK 671 700 1.38e-3 SMART
ANK 704 733 1.58e-7 SMART
ANK 737 766 2.85e-5 SMART
ZU5 923 1027 1.9e-60 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174435
AA Change: E93D

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000133668
Gene: ENSMUSG00000031543
AA Change: E93D

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199351
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 93% (92/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ankyrins are a family of proteins that link the integral membrane proteins to the underlying spectrin-actin cytoskeleton and play key roles in activities such as cell motility, activation, proliferation, contact and the maintenance of specialized membrane domains. Multiple isoforms of ankyrin with different affinities for various target proteins are expressed in a tissue-specific, developmentally regulated manner. Most ankyrins are typically composed of three structural domains: an amino-terminal domain containing multiple ankyrin repeats; a central region with a highly conserved spectrin binding domain; and a carboxy-terminal regulatory domain which is the least conserved and subject to variation. Ankyrin 1, the prototype of this family, was first discovered in the erythrocytes, but since has also been found in brain and muscles. Mutations in erythrocytic ankyrin 1 have been associated in approximately half of all patients with hereditary spherocytosis. Complex patterns of alternative splicing in the regulatory domain, giving rise to different isoforms of ankyrin 1 have been described. Truncated muscle-specific isoforms of ankyrin 1 resulting from usage of an alternate promoter have also been identified. [provided by RefSeq, Dec 2008]
PHENOTYPE: Homozygous mutant animals are anemic, infertile, and have reduced body size. Mutant animals also exhibit jaundice, bone marrow hyperplasia, splenomegaly, hepatomegaly, enlarged lymph nodes, increased white blood cell count, and cardiac hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik G T 17: 33,066,150 D559E probably benign Het
4931429L15Rik A T 9: 46,306,822 I206N probably damaging Het
Aadac T A 3: 60,039,827 D315E probably damaging Het
Abcc8 A G 7: 46,123,906 F800L probably benign Het
Adamts16 C A 13: 70,728,910 C1204F probably damaging Het
Adcy7 A G 8: 88,312,228 T291A possibly damaging Het
AI182371 G T 2: 35,086,122 Q255K possibly damaging Het
Aig1 A T 10: 13,801,784 probably benign Het
Ak5 T C 3: 152,615,952 D266G probably damaging Het
Bop1 T C 15: 76,455,917 D153G probably damaging Het
Bub1 G T 2: 127,819,222 N316K probably benign Het
Capn1 T C 19: 5,997,797 N412S probably benign Het
Cdca4 A G 12: 112,821,719 S130P probably benign Het
Cdh23 A T 10: 60,428,379 D663E probably damaging Het
Clca3a1 T C 3: 144,749,642 probably benign Het
Csmd2 C T 4: 128,197,385 P239L probably damaging Het
Dlg2 A T 7: 91,997,371 probably benign Het
Dnpep C T 1: 75,311,991 probably null Het
Dopey2 A T 16: 93,801,581 H1878L probably damaging Het
Dscam C T 16: 96,820,920 D444N probably damaging Het
Emc9 C T 14: 55,582,112 probably null Het
Ero1lb T A 13: 12,600,318 I346N probably damaging Het
Etv3 A G 3: 87,535,543 T145A probably benign Het
Fam170a T A 18: 50,282,254 probably null Het
Fap A T 2: 62,544,356 I261N probably damaging Het
Fbn2 T C 18: 58,045,337 N1943S probably damaging Het
Glb1l3 A T 9: 26,826,383 V466E probably damaging Het
Gm10521 A T 1: 171,896,503 H127L unknown Het
Gm8186 G T 17: 26,099,156 N22K probably damaging Het
Gpr132 A C 12: 112,852,097 L370V probably benign Het
Hectd1 A T 12: 51,798,754 H449Q probably damaging Het
Hook3 A G 8: 26,044,278 probably benign Het
Ift140 A G 17: 25,092,371 D1180G probably benign Het
Isoc2b A T 7: 4,849,578 probably null Het
Itga4 C T 2: 79,322,656 H896Y probably benign Het
Itga7 T C 10: 128,942,981 Y326H probably damaging Het
Itpr3 A T 17: 27,117,893 E2397V probably damaging Het
Jtb T G 3: 90,235,577 probably null Het
Klk15 A G 7: 43,938,759 T164A probably benign Het
Kmt2e C A 5: 23,464,706 H64N probably damaging Het
Lamtor3 T A 3: 137,927,293 probably benign Het
Laptm4b A G 15: 34,258,684 I35V possibly damaging Het
Lrrc1 A C 9: 77,434,097 L393R probably damaging Het
Ltn1 A G 16: 87,381,503 S1613P possibly damaging Het
Mtmr4 T A 11: 87,612,050 W920R probably damaging Het
Nbeal1 T C 1: 60,228,791 probably benign Het
Nup133 A G 8: 123,916,299 Y761H possibly damaging Het
Nwd2 T A 5: 63,805,983 V970D probably damaging Het
Olfr1058 A T 2: 86,385,874 S181R probably damaging Het
Olfr1261 A G 2: 89,993,957 H188R probably benign Het
Olfr429 T C 1: 174,089,219 Y60H probably benign Het
Osbp C T 19: 11,973,876 L262F probably damaging Het
Phldb2 G T 16: 45,825,188 D343E probably damaging Het
Phrf1 T A 7: 141,260,540 M1216K possibly damaging Het
Phyh A T 2: 4,930,651 probably null Het
Plekhf1 A T 7: 38,222,170 probably null Het
Rars T C 11: 35,828,648 N116D probably damaging Het
Rnf44 T A 13: 54,682,808 Q181L possibly damaging Het
Rpe65 T C 3: 159,615,682 probably null Het
Scaf1 A G 7: 45,013,592 probably benign Het
Serpinb11 A T 1: 107,372,189 R88S probably benign Het
Slc7a7 T C 14: 54,379,103 N174S probably damaging Het
Slc9a5 T C 8: 105,357,175 probably null Het
Slfn1 C A 11: 83,121,176 N39K possibly damaging Het
Snx20 G A 8: 88,627,295 A269V possibly damaging Het
Snx6 A G 12: 54,754,319 Y298H probably damaging Het
Stk32c C T 7: 139,120,674 R213Q probably benign Het
Tgfbr1 A T 4: 47,396,555 I190F probably damaging Het
Ube2d2b T A 5: 107,830,632 F50I probably damaging Het
Ubl5 G A 9: 20,646,534 probably benign Het
Ubqln5 T G 7: 104,128,574 T348P possibly damaging Het
Usp46 T C 5: 74,037,085 D22G probably benign Het
Vars A G 17: 35,012,376 N655S probably damaging Het
Vmn2r103 A C 17: 19,812,453 I830L possibly damaging Het
Vmn2r26 T A 6: 124,039,871 N431K probably benign Het
Vmn2r4 G T 3: 64,391,066 P547Q probably damaging Het
Yy1 T A 12: 108,806,428 probably benign Het
Zbtb2 A T 10: 4,368,592 L478Q possibly damaging Het
Zfp12 T C 5: 143,239,988 F17S probably damaging Het
Zfp219 T A 14: 52,007,149 probably null Het
Zfp629 G A 7: 127,610,370 H756Y probably damaging Het
Zfp748 T C 13: 67,541,173 K656R possibly damaging Het
Zfp958 T A 8: 4,629,072 Y366N probably benign Het
Zp3 C T 5: 135,988,523 T396I probably benign Het
Other mutations in Ank1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Ank1 APN 8 23141644 missense probably damaging 1.00
IGL01099:Ank1 APN 8 23108249 missense probably damaging 0.97
IGL01586:Ank1 APN 8 23120912 missense probably benign
IGL01866:Ank1 APN 8 23093855 missense possibly damaging 0.88
IGL01977:Ank1 APN 8 23115433 missense probably benign 0.01
IGL02109:Ank1 APN 8 23096184 missense probably damaging 1.00
IGL02182:Ank1 APN 8 23113852 missense possibly damaging 0.89
IGL02261:Ank1 APN 8 23087999 missense probably damaging 1.00
IGL02283:Ank1 APN 8 23119434 critical splice donor site probably null
IGL02335:Ank1 APN 8 23135638 missense possibly damaging 0.86
IGL02933:Ank1 APN 8 23122865 missense possibly damaging 0.52
IGL03056:Ank1 APN 8 23141179 missense probably damaging 1.00
IGL03089:Ank1 APN 8 23104832 missense probably benign 0.00
IGL03257:Ank1 APN 8 23122898 missense probably damaging 1.00
IGL03389:Ank1 APN 8 23088060 critical splice donor site probably null
Hema6 UTSW 8 23097638 intron probably benign
R0030:Ank1 UTSW 8 23093893 missense probably damaging 1.00
R0077:Ank1 UTSW 8 23140167 missense probably damaging 1.00
R0081:Ank1 UTSW 8 23116242 missense possibly damaging 0.95
R0147:Ank1 UTSW 8 23123977 missense probably damaging 1.00
R0148:Ank1 UTSW 8 23123977 missense probably damaging 1.00
R0200:Ank1 UTSW 8 23096812 missense probably damaging 1.00
R0270:Ank1 UTSW 8 23088925 splice site probably benign
R0309:Ank1 UTSW 8 23104809 missense probably damaging 1.00
R0490:Ank1 UTSW 8 23107874 splice site probably benign
R0675:Ank1 UTSW 8 23110384 splice site probably benign
R0738:Ank1 UTSW 8 23114114 missense probably damaging 0.98
R1051:Ank1 UTSW 8 23093940 missense probably damaging 1.00
R1239:Ank1 UTSW 8 23096155 missense probably damaging 1.00
R1265:Ank1 UTSW 8 23117037 missense possibly damaging 0.64
R1367:Ank1 UTSW 8 23111803 splice site probably benign
R1413:Ank1 UTSW 8 23119377 missense probably damaging 1.00
R1539:Ank1 UTSW 8 23093919 missense probably damaging 1.00
R1682:Ank1 UTSW 8 23109327 missense probably damaging 1.00
R1732:Ank1 UTSW 8 23111463 splice site probably benign
R1911:Ank1 UTSW 8 23099650 missense probably damaging 1.00
R2087:Ank1 UTSW 8 23093811 missense probably damaging 1.00
R2184:Ank1 UTSW 8 23109254 missense probably damaging 0.98
R2302:Ank1 UTSW 8 23119399 missense probably damaging 1.00
R2356:Ank1 UTSW 8 23085672 missense probably damaging 1.00
R2495:Ank1 UTSW 8 23132264 missense probably damaging 1.00
R3000:Ank1 UTSW 8 23119431 missense probably damaging 1.00
R3113:Ank1 UTSW 8 23084797 missense probably damaging 1.00
R3710:Ank1 UTSW 8 23087079 missense probably damaging 1.00
R3768:Ank1 UTSW 8 23116186 missense possibly damaging 0.92
R3771:Ank1 UTSW 8 23123897 missense probably benign 0.03
R4002:Ank1 UTSW 8 23139463 missense probably damaging 0.98
R4478:Ank1 UTSW 8 23120578 missense probably benign 0.30
R4755:Ank1 UTSW 8 23104974 missense probably damaging 1.00
R4756:Ank1 UTSW 8 23122877 missense probably benign
R4979:Ank1 UTSW 8 23132196 missense probably damaging 0.98
R4989:Ank1 UTSW 8 23141118 intron probably benign
R5011:Ank1 UTSW 8 23082284 missense probably damaging 1.00
R5013:Ank1 UTSW 8 23082284 missense probably damaging 1.00
R5031:Ank1 UTSW 8 23099680 missense probably damaging 1.00
R5051:Ank1 UTSW 8 23119381 missense probably damaging 1.00
R5059:Ank1 UTSW 8 23096188 missense probably damaging 0.99
R5086:Ank1 UTSW 8 23088618 missense probably damaging 1.00
R5108:Ank1 UTSW 8 23132555 missense probably benign 0.11
R5235:Ank1 UTSW 8 23082196 missense probably damaging 1.00
R5300:Ank1 UTSW 8 23132501 missense probably benign 0.00
R5408:Ank1 UTSW 8 23082193 missense probably damaging 1.00
R5537:Ank1 UTSW 8 23114876 missense probably damaging 1.00
R5728:Ank1 UTSW 8 23122767 critical splice acceptor site probably null
R5746:Ank1 UTSW 8 23116596 missense probably damaging 1.00
R5837:Ank1 UTSW 8 23104790 missense probably damaging 0.99
R5997:Ank1 UTSW 8 23099662 missense probably damaging 1.00
R6005:Ank1 UTSW 8 23132202 missense probably damaging 1.00
R6046:Ank1 UTSW 8 23116098 missense probably damaging 1.00
R6103:Ank1 UTSW 8 23113983 missense probably damaging 1.00
R6268:Ank1 UTSW 8 23109671 missense probably damaging 1.00
R6430:Ank1 UTSW 8 23132109 missense probably damaging 1.00
R6457:Ank1 UTSW 8 23087967 missense probably damaging 1.00
R6626:Ank1 UTSW 8 22975191 missense probably damaging 0.98
R6935:Ank1 UTSW 8 23108231 missense probably damaging 1.00
R7091:Ank1 UTSW 8 23058663 missense probably benign
R7162:Ank1 UTSW 8 23132354 missense possibly damaging 0.94
R7475:Ank1 UTSW 8 23132630 missense probably benign
R7546:Ank1 UTSW 8 23064995 missense probably damaging 1.00
R7678:Ank1 UTSW 8 23117058 missense probably damaging 0.98
X0066:Ank1 UTSW 8 23141584 splice site probably null
Predicted Primers PCR Primer
(F):5'- AGCATGGGAGCCCTTGTTTG -3'
(R):5'- GAGTTACCCCGAAAGCTCTGAG -3'

Sequencing Primer
(F):5'- GCTGAACTTCGGGCTTGATTG -3'
(R):5'- CCGAAAGCTCTGAGGTGGG -3'
Posted On2017-02-28