Incidental Mutation 'R5907:Ank1'
ID 460715
Institutional Source Beutler Lab
Gene Symbol Ank1
Ensembl Gene ENSMUSG00000031543
Gene Name ankyrin 1, erythroid
Synonyms Ank-1, pale
MMRRC Submission 044104-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.447) question?
Stock # R5907 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 23464860-23640513 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 23630220 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 93 (E93D)
Ref Sequence ENSEMBL: ENSMUSP00000112966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033947] [ENSMUST00000084038] [ENSMUST00000110688] [ENSMUST00000117270] [ENSMUST00000117296] [ENSMUST00000117662] [ENSMUST00000118733] [ENSMUST00000121075] [ENSMUST00000121802] [ENSMUST00000141784] [ENSMUST00000173248] [ENSMUST00000174435] [ENSMUST00000173573] [ENSMUST00000123418]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000033947
AA Change: E93D

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000033947
Gene: ENSMUSG00000031543
AA Change: E93D

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000084038
AA Change: E1786D

PolyPhen 2 Score 0.539 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000081051
Gene: ENSMUSG00000031543
AA Change: E1786D

DomainStartEndE-ValueType
ANK 15 44 2.5e3 SMART
ANK 48 77 3.26e0 SMART
ANK 81 110 3.15e-7 SMART
ANK 114 143 9.05e-8 SMART
ANK 147 175 4.67e-1 SMART
ANK 176 205 1.42e0 SMART
ANK 209 238 4.39e-6 SMART
ANK 242 271 1.33e-5 SMART
ANK 275 304 7.53e-5 SMART
ANK 308 337 2.35e-6 SMART
ANK 341 370 6.65e-6 SMART
ANK 374 403 5.2e-8 SMART
ANK 407 436 8.78e-6 SMART
ANK 440 469 7.53e-5 SMART
ANK 473 502 5.49e-7 SMART
ANK 506 535 2.58e-3 SMART
ANK 539 568 1.88e-5 SMART
ANK 572 601 1.02e-6 SMART
ANK 605 634 7.64e-6 SMART
ANK 638 669 3.23e-4 SMART
ANK 671 700 1.38e-3 SMART
ANK 704 733 1.58e-7 SMART
ANK 737 766 2.85e-5 SMART
ZU5 923 1027 1.9e-60 SMART
low complexity region 1050 1059 N/A INTRINSIC
low complexity region 1387 1397 N/A INTRINSIC
DEATH 1405 1499 3.21e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000093576
Predicted Effect probably benign
Transcript: ENSMUST00000110688
AA Change: E1682D

PolyPhen 2 Score 0.174 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000106316
Gene: ENSMUSG00000031543
AA Change: E1682D

DomainStartEndE-ValueType
coiled coil region 1 39 N/A INTRINSIC
ANK 44 73 2.5e3 SMART
ANK 77 106 3.26e0 SMART
ANK 110 139 3.15e-7 SMART
ANK 143 172 9.05e-8 SMART
ANK 176 204 4.67e-1 SMART
ANK 205 234 1.42e0 SMART
ANK 238 267 4.39e-6 SMART
ANK 271 300 1.33e-5 SMART
ANK 304 333 7.53e-5 SMART
ANK 337 366 2.35e-6 SMART
ANK 370 399 6.65e-6 SMART
ANK 403 432 5.2e-8 SMART
ANK 436 465 8.78e-6 SMART
ANK 469 498 7.53e-5 SMART
ANK 502 531 5.49e-7 SMART
ANK 535 564 2.58e-3 SMART
ANK 568 597 1.88e-5 SMART
ANK 601 630 1.02e-6 SMART
ANK 634 663 7.64e-6 SMART
ANK 667 698 3.23e-4 SMART
ANK 700 729 1.38e-3 SMART
ANK 733 762 1.58e-7 SMART
ANK 766 795 2.85e-5 SMART
ZU5 944 1048 1.9e-60 SMART
low complexity region 1071 1080 N/A INTRINSIC
low complexity region 1408 1418 N/A INTRINSIC
DEATH 1426 1520 3.21e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117270
AA Change: E1845D

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000113495
Gene: ENSMUSG00000031543
AA Change: E1845D

DomainStartEndE-ValueType
coiled coil region 1 39 N/A INTRINSIC
ANK 44 73 2.5e3 SMART
ANK 77 106 3.26e0 SMART
ANK 110 139 3.15e-7 SMART
ANK 143 172 9.05e-8 SMART
ANK 176 204 4.67e-1 SMART
ANK 205 234 1.42e0 SMART
ANK 238 267 4.39e-6 SMART
ANK 271 300 1.33e-5 SMART
ANK 304 333 7.53e-5 SMART
ANK 337 366 2.35e-6 SMART
ANK 370 399 6.65e-6 SMART
ANK 403 432 5.2e-8 SMART
ANK 436 465 8.78e-6 SMART
ANK 469 498 7.53e-5 SMART
ANK 502 531 5.49e-7 SMART
ANK 535 564 2.58e-3 SMART
ANK 568 597 1.88e-5 SMART
ANK 601 630 1.02e-6 SMART
ANK 634 663 7.64e-6 SMART
ANK 667 698 3.23e-4 SMART
ANK 700 729 1.38e-3 SMART
ANK 733 762 1.58e-7 SMART
ANK 766 795 2.85e-5 SMART
ZU5 952 1056 1.9e-60 SMART
low complexity region 1079 1088 N/A INTRINSIC
low complexity region 1416 1426 N/A INTRINSIC
DEATH 1434 1528 3.21e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117296
AA Change: E1800D

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000113656
Gene: ENSMUSG00000031543
AA Change: E1800D

DomainStartEndE-ValueType
ANK 7 36 2.5e3 SMART
ANK 40 69 3.26e0 SMART
ANK 73 102 3.15e-7 SMART
ANK 106 135 9.05e-8 SMART
ANK 139 167 4.67e-1 SMART
ANK 168 197 1.42e0 SMART
ANK 201 230 4.39e-6 SMART
ANK 234 263 1.33e-5 SMART
ANK 267 296 7.53e-5 SMART
ANK 300 329 2.35e-6 SMART
ANK 333 362 6.65e-6 SMART
ANK 366 395 5.2e-8 SMART
ANK 399 428 8.78e-6 SMART
ANK 432 461 7.53e-5 SMART
ANK 465 494 5.49e-7 SMART
ANK 498 527 2.58e-3 SMART
ANK 531 560 1.88e-5 SMART
ANK 564 593 1.02e-6 SMART
ANK 597 626 7.64e-6 SMART
ANK 630 661 3.23e-4 SMART
ANK 663 692 1.38e-3 SMART
ANK 696 725 1.58e-7 SMART
ANK 729 758 2.85e-5 SMART
ZU5 907 1011 1.9e-60 SMART
low complexity region 1034 1043 N/A INTRINSIC
low complexity region 1371 1381 N/A INTRINSIC
DEATH 1389 1483 3.21e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117662
AA Change: E1800D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113531
Gene: ENSMUSG00000031543
AA Change: E1800D

DomainStartEndE-ValueType
ANK 7 36 2.5e3 SMART
ANK 40 69 3.26e0 SMART
ANK 73 102 3.15e-7 SMART
ANK 106 135 9.05e-8 SMART
ANK 139 167 4.67e-1 SMART
ANK 168 197 1.42e0 SMART
ANK 201 230 4.39e-6 SMART
ANK 234 263 1.33e-5 SMART
ANK 267 296 7.53e-5 SMART
ANK 300 329 2.35e-6 SMART
ANK 333 362 6.65e-6 SMART
ANK 366 395 5.2e-8 SMART
ANK 399 428 8.78e-6 SMART
ANK 432 461 7.53e-5 SMART
ANK 465 494 5.49e-7 SMART
ANK 498 527 2.58e-3 SMART
ANK 531 560 1.88e-5 SMART
ANK 564 593 1.02e-6 SMART
ANK 597 626 7.64e-6 SMART
ANK 630 661 3.23e-4 SMART
ANK 663 692 1.38e-3 SMART
ANK 696 725 1.58e-7 SMART
ANK 729 758 2.85e-5 SMART
ZU5 907 1011 1.9e-60 SMART
low complexity region 1034 1043 N/A INTRINSIC
low complexity region 1371 1381 N/A INTRINSIC
DEATH 1389 1483 3.21e-26 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000118733
AA Change: E1816D

PolyPhen 2 Score 0.539 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000112850
Gene: ENSMUSG00000031543
AA Change: E1816D

DomainStartEndE-ValueType
ANK 15 44 2.5e3 SMART
ANK 48 77 3.26e0 SMART
ANK 81 110 3.15e-7 SMART
ANK 114 143 9.05e-8 SMART
ANK 147 175 4.67e-1 SMART
ANK 176 205 1.42e0 SMART
ANK 209 238 4.39e-6 SMART
ANK 242 271 1.33e-5 SMART
ANK 275 304 7.53e-5 SMART
ANK 308 337 2.35e-6 SMART
ANK 341 370 6.65e-6 SMART
ANK 374 403 5.2e-8 SMART
ANK 407 436 8.78e-6 SMART
ANK 440 469 7.53e-5 SMART
ANK 473 502 5.49e-7 SMART
ANK 506 535 2.58e-3 SMART
ANK 539 568 1.88e-5 SMART
ANK 572 601 1.02e-6 SMART
ANK 605 634 7.64e-6 SMART
ANK 638 669 3.23e-4 SMART
ANK 671 700 1.38e-3 SMART
ANK 704 733 1.58e-7 SMART
ANK 737 766 2.85e-5 SMART
ZU5 923 1027 1.9e-60 SMART
low complexity region 1050 1059 N/A INTRINSIC
low complexity region 1387 1397 N/A INTRINSIC
DEATH 1405 1499 3.21e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121075
AA Change: E93D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112966
Gene: ENSMUSG00000031543
AA Change: E93D

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130311
Predicted Effect probably benign
Transcript: ENSMUST00000121802
AA Change: E1845D

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000113571
Gene: ENSMUSG00000031543
AA Change: E1845D

DomainStartEndE-ValueType
coiled coil region 1 39 N/A INTRINSIC
ANK 44 73 2.5e3 SMART
ANK 77 106 3.26e0 SMART
ANK 110 139 3.15e-7 SMART
ANK 143 172 9.05e-8 SMART
ANK 176 204 4.67e-1 SMART
ANK 205 234 1.42e0 SMART
ANK 238 267 4.39e-6 SMART
ANK 271 300 1.33e-5 SMART
ANK 304 333 7.53e-5 SMART
ANK 337 366 2.35e-6 SMART
ANK 370 399 6.65e-6 SMART
ANK 403 432 5.2e-8 SMART
ANK 436 465 8.78e-6 SMART
ANK 469 498 7.53e-5 SMART
ANK 502 531 5.49e-7 SMART
ANK 535 564 2.58e-3 SMART
ANK 568 597 1.88e-5 SMART
ANK 601 630 1.02e-6 SMART
ANK 634 663 7.64e-6 SMART
ANK 667 698 3.23e-4 SMART
ANK 700 729 1.38e-3 SMART
ANK 733 762 1.58e-7 SMART
ANK 766 795 2.85e-5 SMART
ZU5 952 1056 1.9e-60 SMART
low complexity region 1079 1088 N/A INTRINSIC
low complexity region 1416 1426 N/A INTRINSIC
DEATH 1434 1528 3.21e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141784
AA Change: E1800D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117966
Gene: ENSMUSG00000031543
AA Change: E1800D

DomainStartEndE-ValueType
ANK 7 36 2.5e3 SMART
ANK 40 69 3.26e0 SMART
ANK 73 102 3.15e-7 SMART
ANK 106 135 9.05e-8 SMART
ANK 139 167 4.67e-1 SMART
ANK 168 197 1.42e0 SMART
ANK 201 230 4.39e-6 SMART
ANK 234 263 1.33e-5 SMART
ANK 267 296 7.53e-5 SMART
ANK 300 329 2.35e-6 SMART
ANK 333 362 6.65e-6 SMART
ANK 366 395 5.2e-8 SMART
ANK 399 428 8.78e-6 SMART
ANK 432 461 7.53e-5 SMART
ANK 465 494 5.49e-7 SMART
ANK 498 527 2.58e-3 SMART
ANK 531 560 1.88e-5 SMART
ANK 564 593 1.02e-6 SMART
ANK 597 626 7.64e-6 SMART
ANK 630 661 3.23e-4 SMART
ANK 663 692 1.38e-3 SMART
ANK 696 725 1.58e-7 SMART
ANK 729 758 2.85e-5 SMART
ZU5 907 1011 1.9e-60 SMART
low complexity region 1034 1043 N/A INTRINSIC
low complexity region 1371 1381 N/A INTRINSIC
DEATH 1389 1483 3.21e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141930
Predicted Effect probably benign
Transcript: ENSMUST00000173248
AA Change: E1790D

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000133322
Gene: ENSMUSG00000031543
AA Change: E1790D

DomainStartEndE-ValueType
ANK 15 44 2.5e3 SMART
ANK 48 77 3.26e0 SMART
ANK 81 110 3.15e-7 SMART
ANK 114 143 9.05e-8 SMART
ANK 147 175 4.67e-1 SMART
ANK 176 205 1.42e0 SMART
ANK 209 238 4.39e-6 SMART
ANK 242 271 1.33e-5 SMART
ANK 275 304 7.53e-5 SMART
ANK 308 337 2.35e-6 SMART
ANK 341 370 6.65e-6 SMART
ANK 374 403 5.2e-8 SMART
ANK 407 436 8.78e-6 SMART
ANK 440 469 7.53e-5 SMART
ANK 473 502 5.49e-7 SMART
ANK 506 535 2.58e-3 SMART
ANK 539 568 1.88e-5 SMART
ANK 572 601 1.02e-6 SMART
ANK 605 634 7.64e-6 SMART
ANK 638 669 3.23e-4 SMART
ANK 671 700 1.38e-3 SMART
ANK 704 733 1.58e-7 SMART
ANK 737 766 2.85e-5 SMART
ZU5 923 1027 1.9e-60 SMART
low complexity region 1050 1059 N/A INTRINSIC
low complexity region 1387 1397 N/A INTRINSIC
DEATH 1405 1499 3.21e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174435
AA Change: E93D

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000133668
Gene: ENSMUSG00000031543
AA Change: E93D

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199351
Predicted Effect probably benign
Transcript: ENSMUST00000173573
SMART Domains Protein: ENSMUSP00000133901
Gene: ENSMUSG00000031543

DomainStartEndE-ValueType
ANK 15 44 2.5e3 SMART
ANK 48 77 3.26e0 SMART
ANK 81 110 3.15e-7 SMART
ANK 114 143 9.05e-8 SMART
ANK 147 175 4.67e-1 SMART
ANK 176 205 1.42e0 SMART
ANK 209 238 4.39e-6 SMART
ANK 242 271 1.33e-5 SMART
ANK 275 304 7.53e-5 SMART
ANK 308 337 2.35e-6 SMART
ANK 341 370 6.65e-6 SMART
ANK 374 403 5.2e-8 SMART
ANK 407 436 8.78e-6 SMART
ANK 440 469 7.53e-5 SMART
ANK 473 502 5.49e-7 SMART
ANK 506 535 2.58e-3 SMART
ANK 539 568 1.88e-5 SMART
ANK 572 601 1.02e-6 SMART
ANK 605 634 7.64e-6 SMART
ANK 638 669 3.23e-4 SMART
ANK 671 700 1.38e-3 SMART
ANK 704 733 1.58e-7 SMART
ANK 737 766 2.85e-5 SMART
ZU5 923 1027 1.9e-60 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123418
SMART Domains Protein: ENSMUSP00000121785
Gene: ENSMUSG00000031543

DomainStartEndE-ValueType
ANK 15 44 2.5e3 SMART
ANK 48 77 3.26e0 SMART
ANK 81 110 3.15e-7 SMART
ANK 114 143 9.05e-8 SMART
ANK 147 175 4.67e-1 SMART
ANK 176 205 1.42e0 SMART
ANK 209 238 4.39e-6 SMART
ANK 242 271 1.33e-5 SMART
ANK 275 304 7.53e-5 SMART
ANK 308 337 2.35e-6 SMART
ANK 341 370 6.65e-6 SMART
ANK 374 403 5.2e-8 SMART
ANK 407 436 8.78e-6 SMART
ANK 440 469 7.53e-5 SMART
ANK 473 502 5.49e-7 SMART
ANK 506 535 2.58e-3 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 93% (92/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ankyrins are a family of proteins that link the integral membrane proteins to the underlying spectrin-actin cytoskeleton and play key roles in activities such as cell motility, activation, proliferation, contact and the maintenance of specialized membrane domains. Multiple isoforms of ankyrin with different affinities for various target proteins are expressed in a tissue-specific, developmentally regulated manner. Most ankyrins are typically composed of three structural domains: an amino-terminal domain containing multiple ankyrin repeats; a central region with a highly conserved spectrin binding domain; and a carboxy-terminal regulatory domain which is the least conserved and subject to variation. Ankyrin 1, the prototype of this family, was first discovered in the erythrocytes, but since has also been found in brain and muscles. Mutations in erythrocytic ankyrin 1 have been associated in approximately half of all patients with hereditary spherocytosis. Complex patterns of alternative splicing in the regulatory domain, giving rise to different isoforms of ankyrin 1 have been described. Truncated muscle-specific isoforms of ankyrin 1 resulting from usage of an alternate promoter have also been identified. [provided by RefSeq, Dec 2008]
PHENOTYPE: Homozygous mutant animals are anemic, infertile, and have reduced body size. Mutant animals also exhibit jaundice, bone marrow hyperplasia, splenomegaly, hepatomegaly, enlarged lymph nodes, increased white blood cell count, and cardiac hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik A T 9: 46,218,120 (GRCm39) I206N probably damaging Het
Aadac T A 3: 59,947,248 (GRCm39) D315E probably damaging Het
Abcc8 A G 7: 45,773,330 (GRCm39) F800L probably benign Het
Adamts16 C A 13: 70,877,029 (GRCm39) C1204F probably damaging Het
Adcy7 A G 8: 89,038,856 (GRCm39) T291A possibly damaging Het
AI182371 G T 2: 34,976,134 (GRCm39) Q255K possibly damaging Het
Aig1 A T 10: 13,677,528 (GRCm39) probably benign Het
Ak5 T C 3: 152,321,589 (GRCm39) D266G probably damaging Het
Bop1 T C 15: 76,340,117 (GRCm39) D153G probably damaging Het
Bub1 G T 2: 127,661,142 (GRCm39) N316K probably benign Het
Capn1 T C 19: 6,047,827 (GRCm39) N412S probably benign Het
Cdca4 A G 12: 112,785,339 (GRCm39) S130P probably benign Het
Cdh23 A T 10: 60,264,158 (GRCm39) D663E probably damaging Het
Clca3a1 T C 3: 144,455,403 (GRCm39) probably benign Het
Csmd2 C T 4: 128,091,178 (GRCm39) P239L probably damaging Het
Dlg2 A T 7: 91,646,579 (GRCm39) probably benign Het
Dnpep C T 1: 75,288,635 (GRCm39) probably null Het
Dop1b A T 16: 93,598,469 (GRCm39) H1878L probably damaging Het
Dscam C T 16: 96,622,120 (GRCm39) D444N probably damaging Het
Emc9 C T 14: 55,819,569 (GRCm39) probably null Het
Ero1b T A 13: 12,615,207 (GRCm39) I346N probably damaging Het
Etv3 A G 3: 87,442,850 (GRCm39) T145A probably benign Het
Fam170a T A 18: 50,415,321 (GRCm39) probably null Het
Fap A T 2: 62,374,700 (GRCm39) I261N probably damaging Het
Fbn2 T C 18: 58,178,409 (GRCm39) N1943S probably damaging Het
Glb1l3 A T 9: 26,737,679 (GRCm39) V466E probably damaging Het
Gm10521 A T 1: 171,724,070 (GRCm39) H127L unknown Het
Gm8186 G T 17: 26,318,130 (GRCm39) N22K probably damaging Het
Gpr132 A C 12: 112,815,717 (GRCm39) L370V probably benign Het
Hectd1 A T 12: 51,845,537 (GRCm39) H449Q probably damaging Het
Hook3 A G 8: 26,534,306 (GRCm39) probably benign Het
Ift140 A G 17: 25,311,345 (GRCm39) D1180G probably benign Het
Isoc2b A T 7: 4,852,577 (GRCm39) probably null Het
Itga4 C T 2: 79,153,000 (GRCm39) H896Y probably benign Het
Itga7 T C 10: 128,778,850 (GRCm39) Y326H probably damaging Het
Itpr3 A T 17: 27,336,867 (GRCm39) E2397V probably damaging Het
Jtb T G 3: 90,142,884 (GRCm39) probably null Het
Klk15 A G 7: 43,588,183 (GRCm39) T164A probably benign Het
Kmt2e C A 5: 23,669,704 (GRCm39) H64N probably damaging Het
Lamtor3 T A 3: 137,633,054 (GRCm39) probably benign Het
Laptm4b A G 15: 34,258,830 (GRCm39) I35V possibly damaging Het
Lrrc1 A C 9: 77,341,379 (GRCm39) L393R probably damaging Het
Ltn1 A G 16: 87,178,391 (GRCm39) S1613P possibly damaging Het
Mtmr4 T A 11: 87,502,876 (GRCm39) W920R probably damaging Het
Nbeal1 T C 1: 60,267,950 (GRCm39) probably benign Het
Nup133 A G 8: 124,643,038 (GRCm39) Y761H possibly damaging Het
Nwd2 T A 5: 63,963,326 (GRCm39) V970D probably damaging Het
Or4c126 A G 2: 89,824,301 (GRCm39) H188R probably benign Het
Or6n1 T C 1: 173,916,785 (GRCm39) Y60H probably benign Het
Or8k24 A T 2: 86,216,218 (GRCm39) S181R probably damaging Het
Osbp C T 19: 11,951,240 (GRCm39) L262F probably damaging Het
Phf8-ps G T 17: 33,285,124 (GRCm39) D559E probably benign Het
Phldb2 G T 16: 45,645,551 (GRCm39) D343E probably damaging Het
Phrf1 T A 7: 140,840,453 (GRCm39) M1216K possibly damaging Het
Phyh A T 2: 4,935,462 (GRCm39) probably null Het
Plekhf1 A T 7: 37,921,594 (GRCm39) probably null Het
Rars1 T C 11: 35,719,475 (GRCm39) N116D probably damaging Het
Rnf44 T A 13: 54,830,621 (GRCm39) Q181L possibly damaging Het
Rpe65 T C 3: 159,321,319 (GRCm39) probably null Het
Scaf1 A G 7: 44,663,016 (GRCm39) probably benign Het
Serpinb11 A T 1: 107,299,919 (GRCm39) R88S probably benign Het
Slc7a7 T C 14: 54,616,560 (GRCm39) N174S probably damaging Het
Slc9a5 T C 8: 106,083,807 (GRCm39) probably null Het
Slfn1 C A 11: 83,012,002 (GRCm39) N39K possibly damaging Het
Snx20 G A 8: 89,353,923 (GRCm39) A269V possibly damaging Het
Snx6 A G 12: 54,801,104 (GRCm39) Y298H probably damaging Het
Stk32c C T 7: 138,700,590 (GRCm39) R213Q probably benign Het
Tgfbr1 A T 4: 47,396,555 (GRCm39) I190F probably damaging Het
Ube2d2b T A 5: 107,978,498 (GRCm39) F50I probably damaging Het
Ubl5 G A 9: 20,557,830 (GRCm39) probably benign Het
Ubqln5 T G 7: 103,777,781 (GRCm39) T348P possibly damaging Het
Usp46 T C 5: 74,197,746 (GRCm39) D22G probably benign Het
Vars1 A G 17: 35,231,352 (GRCm39) N655S probably damaging Het
Vmn2r103 A C 17: 20,032,715 (GRCm39) I830L possibly damaging Het
Vmn2r26 T A 6: 124,016,830 (GRCm39) N431K probably benign Het
Vmn2r4 G T 3: 64,298,487 (GRCm39) P547Q probably damaging Het
Yy1 T A 12: 108,772,354 (GRCm39) probably benign Het
Zbtb2 A T 10: 4,318,592 (GRCm39) L478Q possibly damaging Het
Zfp12 T C 5: 143,225,743 (GRCm39) F17S probably damaging Het
Zfp219 T A 14: 52,244,606 (GRCm39) probably null Het
Zfp629 G A 7: 127,209,542 (GRCm39) H756Y probably damaging Het
Zfp748 T C 13: 67,689,292 (GRCm39) K656R possibly damaging Het
Zfp958 T A 8: 4,679,072 (GRCm39) Y366N probably benign Het
Zp3 C T 5: 136,017,377 (GRCm39) T396I probably benign Het
Other mutations in Ank1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Ank1 APN 8 23,631,660 (GRCm39) missense probably damaging 1.00
IGL01099:Ank1 APN 8 23,598,265 (GRCm39) missense probably damaging 0.97
IGL01586:Ank1 APN 8 23,610,928 (GRCm39) missense probably benign
IGL01866:Ank1 APN 8 23,583,871 (GRCm39) missense possibly damaging 0.88
IGL01977:Ank1 APN 8 23,605,449 (GRCm39) missense probably benign 0.01
IGL02109:Ank1 APN 8 23,586,200 (GRCm39) missense probably damaging 1.00
IGL02182:Ank1 APN 8 23,603,868 (GRCm39) missense possibly damaging 0.89
IGL02261:Ank1 APN 8 23,578,015 (GRCm39) missense probably damaging 1.00
IGL02283:Ank1 APN 8 23,609,450 (GRCm39) critical splice donor site probably null
IGL02335:Ank1 APN 8 23,625,654 (GRCm39) missense possibly damaging 0.86
IGL02933:Ank1 APN 8 23,612,881 (GRCm39) missense possibly damaging 0.52
IGL03056:Ank1 APN 8 23,631,195 (GRCm39) missense probably damaging 1.00
IGL03089:Ank1 APN 8 23,594,848 (GRCm39) missense probably benign 0.00
IGL03257:Ank1 APN 8 23,612,914 (GRCm39) missense probably damaging 1.00
IGL03389:Ank1 APN 8 23,578,076 (GRCm39) critical splice donor site probably null
Hema6 UTSW 8 23,587,653 (GRCm39) intron probably benign
BB006:Ank1 UTSW 8 23,606,123 (GRCm39) missense probably damaging 1.00
BB016:Ank1 UTSW 8 23,606,123 (GRCm39) missense probably damaging 1.00
R0030:Ank1 UTSW 8 23,583,909 (GRCm39) missense probably damaging 1.00
R0077:Ank1 UTSW 8 23,630,183 (GRCm39) missense probably damaging 1.00
R0081:Ank1 UTSW 8 23,606,258 (GRCm39) missense possibly damaging 0.95
R0147:Ank1 UTSW 8 23,613,993 (GRCm39) missense probably damaging 1.00
R0148:Ank1 UTSW 8 23,613,993 (GRCm39) missense probably damaging 1.00
R0200:Ank1 UTSW 8 23,586,828 (GRCm39) missense probably damaging 1.00
R0270:Ank1 UTSW 8 23,578,941 (GRCm39) splice site probably benign
R0309:Ank1 UTSW 8 23,594,825 (GRCm39) missense probably damaging 1.00
R0490:Ank1 UTSW 8 23,597,890 (GRCm39) splice site probably benign
R0675:Ank1 UTSW 8 23,600,400 (GRCm39) splice site probably benign
R0738:Ank1 UTSW 8 23,604,130 (GRCm39) missense probably damaging 0.98
R1051:Ank1 UTSW 8 23,583,956 (GRCm39) missense probably damaging 1.00
R1239:Ank1 UTSW 8 23,586,171 (GRCm39) missense probably damaging 1.00
R1265:Ank1 UTSW 8 23,607,053 (GRCm39) missense possibly damaging 0.64
R1367:Ank1 UTSW 8 23,601,819 (GRCm39) splice site probably benign
R1413:Ank1 UTSW 8 23,609,393 (GRCm39) missense probably damaging 1.00
R1539:Ank1 UTSW 8 23,583,935 (GRCm39) missense probably damaging 1.00
R1682:Ank1 UTSW 8 23,599,343 (GRCm39) missense probably damaging 1.00
R1732:Ank1 UTSW 8 23,601,479 (GRCm39) splice site probably benign
R1911:Ank1 UTSW 8 23,589,666 (GRCm39) missense probably damaging 1.00
R2087:Ank1 UTSW 8 23,583,827 (GRCm39) missense probably damaging 1.00
R2184:Ank1 UTSW 8 23,599,270 (GRCm39) missense probably damaging 0.98
R2302:Ank1 UTSW 8 23,609,415 (GRCm39) missense probably damaging 1.00
R2356:Ank1 UTSW 8 23,575,688 (GRCm39) missense probably damaging 1.00
R2495:Ank1 UTSW 8 23,622,280 (GRCm39) missense probably damaging 1.00
R3000:Ank1 UTSW 8 23,609,447 (GRCm39) missense probably damaging 1.00
R3113:Ank1 UTSW 8 23,574,813 (GRCm39) missense probably damaging 1.00
R3710:Ank1 UTSW 8 23,577,095 (GRCm39) missense probably damaging 1.00
R3768:Ank1 UTSW 8 23,606,202 (GRCm39) missense possibly damaging 0.92
R3771:Ank1 UTSW 8 23,613,913 (GRCm39) missense probably benign 0.03
R4002:Ank1 UTSW 8 23,629,479 (GRCm39) missense probably damaging 0.98
R4478:Ank1 UTSW 8 23,610,594 (GRCm39) missense probably benign 0.30
R4755:Ank1 UTSW 8 23,594,990 (GRCm39) missense probably damaging 1.00
R4756:Ank1 UTSW 8 23,612,893 (GRCm39) missense probably benign
R4979:Ank1 UTSW 8 23,622,212 (GRCm39) missense probably damaging 0.98
R4989:Ank1 UTSW 8 23,631,134 (GRCm39) intron probably benign
R5011:Ank1 UTSW 8 23,572,300 (GRCm39) missense probably damaging 1.00
R5013:Ank1 UTSW 8 23,572,300 (GRCm39) missense probably damaging 1.00
R5031:Ank1 UTSW 8 23,589,696 (GRCm39) missense probably damaging 1.00
R5051:Ank1 UTSW 8 23,609,397 (GRCm39) missense probably damaging 1.00
R5059:Ank1 UTSW 8 23,586,204 (GRCm39) missense probably damaging 0.99
R5086:Ank1 UTSW 8 23,578,634 (GRCm39) missense probably damaging 1.00
R5108:Ank1 UTSW 8 23,622,571 (GRCm39) missense probably benign 0.11
R5235:Ank1 UTSW 8 23,572,212 (GRCm39) missense probably damaging 1.00
R5300:Ank1 UTSW 8 23,622,517 (GRCm39) missense probably benign 0.00
R5408:Ank1 UTSW 8 23,572,209 (GRCm39) missense probably damaging 1.00
R5537:Ank1 UTSW 8 23,604,892 (GRCm39) missense probably damaging 1.00
R5728:Ank1 UTSW 8 23,612,783 (GRCm39) critical splice acceptor site probably null
R5746:Ank1 UTSW 8 23,606,612 (GRCm39) missense probably damaging 1.00
R5837:Ank1 UTSW 8 23,594,806 (GRCm39) missense probably damaging 0.99
R5997:Ank1 UTSW 8 23,589,678 (GRCm39) missense probably damaging 1.00
R6005:Ank1 UTSW 8 23,622,218 (GRCm39) missense probably damaging 1.00
R6046:Ank1 UTSW 8 23,606,114 (GRCm39) missense probably damaging 1.00
R6103:Ank1 UTSW 8 23,603,999 (GRCm39) missense probably damaging 1.00
R6268:Ank1 UTSW 8 23,599,687 (GRCm39) missense probably damaging 1.00
R6430:Ank1 UTSW 8 23,622,125 (GRCm39) missense probably damaging 1.00
R6457:Ank1 UTSW 8 23,577,983 (GRCm39) missense probably damaging 1.00
R6626:Ank1 UTSW 8 23,465,207 (GRCm39) missense probably damaging 0.98
R6935:Ank1 UTSW 8 23,598,247 (GRCm39) missense probably damaging 1.00
R7091:Ank1 UTSW 8 23,548,679 (GRCm39) missense probably benign
R7162:Ank1 UTSW 8 23,622,370 (GRCm39) missense possibly damaging 0.94
R7475:Ank1 UTSW 8 23,622,646 (GRCm39) missense probably benign
R7546:Ank1 UTSW 8 23,555,011 (GRCm39) missense probably damaging 1.00
R7678:Ank1 UTSW 8 23,607,074 (GRCm39) missense probably damaging 0.98
R7768:Ank1 UTSW 8 23,588,013 (GRCm39) missense probably benign 0.01
R7779:Ank1 UTSW 8 23,586,763 (GRCm39) critical splice acceptor site probably null
R7864:Ank1 UTSW 8 23,577,976 (GRCm39) missense probably damaging 1.00
R7929:Ank1 UTSW 8 23,606,123 (GRCm39) missense probably damaging 1.00
R7982:Ank1 UTSW 8 23,609,397 (GRCm39) missense probably damaging 1.00
R7984:Ank1 UTSW 8 23,578,982 (GRCm39) missense probably damaging 1.00
R8273:Ank1 UTSW 8 23,575,668 (GRCm39) missense probably damaging 1.00
R8318:Ank1 UTSW 8 23,605,567 (GRCm39) missense probably damaging 0.99
R8349:Ank1 UTSW 8 23,629,302 (GRCm39) missense possibly damaging 0.66
R8449:Ank1 UTSW 8 23,629,302 (GRCm39) missense possibly damaging 0.66
R8459:Ank1 UTSW 8 23,605,528 (GRCm39) missense probably damaging 1.00
R8506:Ank1 UTSW 8 23,586,851 (GRCm39) missense probably damaging 1.00
R8889:Ank1 UTSW 8 23,606,990 (GRCm39) missense probably damaging 1.00
R8893:Ank1 UTSW 8 23,598,241 (GRCm39) missense probably damaging 1.00
R8924:Ank1 UTSW 8 23,589,011 (GRCm39) missense probably benign 0.00
R8993:Ank1 UTSW 8 23,588,955 (GRCm39) missense probably damaging 1.00
R9016:Ank1 UTSW 8 23,606,264 (GRCm39) missense probably null 0.99
R9017:Ank1 UTSW 8 23,606,264 (GRCm39) missense probably null 0.99
R9018:Ank1 UTSW 8 23,606,264 (GRCm39) missense probably null 0.99
R9086:Ank1 UTSW 8 23,589,636 (GRCm39) missense probably damaging 0.96
R9154:Ank1 UTSW 8 23,605,387 (GRCm39) missense probably damaging 0.96
R9194:Ank1 UTSW 8 23,606,255 (GRCm39) missense possibly damaging 0.64
R9347:Ank1 UTSW 8 23,607,076 (GRCm39) missense possibly damaging 0.65
R9419:Ank1 UTSW 8 23,574,825 (GRCm39) missense probably damaging 1.00
R9452:Ank1 UTSW 8 23,622,429 (GRCm39) missense probably benign 0.00
R9568:Ank1 UTSW 8 23,609,381 (GRCm39) missense probably benign
R9689:Ank1 UTSW 8 23,631,253 (GRCm39) missense probably benign
R9747:Ank1 UTSW 8 23,576,993 (GRCm39) missense probably damaging 0.97
RF024:Ank1 UTSW 8 23,609,360 (GRCm39) missense probably benign 0.37
X0066:Ank1 UTSW 8 23,631,600 (GRCm39) splice site probably null
Predicted Primers PCR Primer
(F):5'- AGCATGGGAGCCCTTGTTTG -3'
(R):5'- GAGTTACCCCGAAAGCTCTGAG -3'

Sequencing Primer
(F):5'- GCTGAACTTCGGGCTTGATTG -3'
(R):5'- CCGAAAGCTCTGAGGTGGG -3'
Posted On 2017-02-28