Mutagenetix > Incidental Mutation

Incidental Mutation 'R5907:Dopey2'

460746

Institutional Source

Beutler Lab

Gene Symbol

Dopey2

Ensembl Gene

ENSMUSG00000022946

Gene Name

dopey family member 2

Synonyms

0610038M01Rik, 2610510B01Rik

MMRRC Submission

044104-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5907 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

93711904-93810590 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 93801581 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 1878 (H1878L)

Ref Sequence

ENSEMBL: ENSMUSP00000154771 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045004] [ENSMUST00000227156] [ENSMUST00000228261]

AlphaFold

Q3UHQ6

Predicted Effect

probably damaging
Transcript: ENSMUST00000045004
AA Change: H1995L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000044437
Gene: ENSMUSG00000022946
AA Change: H1995L

Domain	Start	End	E-Value	Type
Pfam:Dopey_N	11	308	3.9e-104	PFAM
low complexity region	651	666	N/A	INTRINSIC
low complexity region	709	719	N/A	INTRINSIC
low complexity region	747	759	N/A	INTRINSIC
low complexity region	1186	1199	N/A	INTRINSIC
low complexity region	1436	1451	N/A	INTRINSIC
low complexity region	1893	1908	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000226215
AA Change: H1205L

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226535

Predicted Effect

probably damaging
Transcript: ENSMUST00000227156
AA Change: H1878L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227278

Predicted Effect

probably benign
Transcript: ENSMUST00000228261

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231882

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000232210

Meta Mutation Damage Score

0.2377

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.9%
20x: 93.7%

Validation Efficiency

93% (92/99)

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921501E09Rik	G	T	17: 33,066,150	D559E	probably benign	Het
4931429L15Rik	A	T	9: 46,306,822	I206N	probably damaging	Het
Aadac	T	A	3: 60,039,827	D315E	probably damaging	Het
Abcc8	A	G	7: 46,123,906	F800L	probably benign	Het
Adamts16	C	A	13: 70,728,910	C1204F	probably damaging	Het
Adcy7	A	G	8: 88,312,228	T291A	possibly damaging	Het
AI182371	G	T	2: 35,086,122	Q255K	possibly damaging	Het
Aig1	A	T	10: 13,801,784		probably benign	Het
Ak5	T	C	3: 152,615,952	D266G	probably damaging	Het
Ank1	A	T	8: 23,140,204	E93D	probably damaging	Het
Bop1	T	C	15: 76,455,917	D153G	probably damaging	Het
Bub1	G	T	2: 127,819,222	N316K	probably benign	Het
Capn1	T	C	19: 5,997,797	N412S	probably benign	Het
Cdca4	A	G	12: 112,821,719	S130P	probably benign	Het
Cdh23	A	T	10: 60,428,379	D663E	probably damaging	Het
Clca3a1	T	C	3: 144,749,642		probably benign	Het
Csmd2	C	T	4: 128,197,385	P239L	probably damaging	Het
Dlg2	A	T	7: 91,997,371		probably benign	Het
Dnpep	C	T	1: 75,311,991		probably null	Het
Dscam	C	T	16: 96,820,920	D444N	probably damaging	Het
Emc9	C	T	14: 55,582,112		probably null	Het
Ero1lb	T	A	13: 12,600,318	I346N	probably damaging	Het
Etv3	A	G	3: 87,535,543	T145A	probably benign	Het
Fam170a	T	A	18: 50,282,254		probably null	Het
Fap	A	T	2: 62,544,356	I261N	probably damaging	Het
Fbn2	T	C	18: 58,045,337	N1943S	probably damaging	Het
Glb1l3	A	T	9: 26,826,383	V466E	probably damaging	Het
Gm10521	A	T	1: 171,896,503	H127L	unknown	Het
Gm8186	G	T	17: 26,099,156	N22K	probably damaging	Het
Gpr132	A	C	12: 112,852,097	L370V	probably benign	Het
Hectd1	A	T	12: 51,798,754	H449Q	probably damaging	Het
Hook3	A	G	8: 26,044,278		probably benign	Het
Ift140	A	G	17: 25,092,371	D1180G	probably benign	Het
Isoc2b	A	T	7: 4,849,578		probably null	Het
Itga4	C	T	2: 79,322,656	H896Y	probably benign	Het
Itga7	T	C	10: 128,942,981	Y326H	probably damaging	Het
Itpr3	A	T	17: 27,117,893	E2397V	probably damaging	Het
Jtb	T	G	3: 90,235,577		probably null	Het
Klk15	A	G	7: 43,938,759	T164A	probably benign	Het
Kmt2e	C	A	5: 23,464,706	H64N	probably damaging	Het
Lamtor3	T	A	3: 137,927,293		probably benign	Het
Laptm4b	A	G	15: 34,258,684	I35V	possibly damaging	Het
Lrrc1	A	C	9: 77,434,097	L393R	probably damaging	Het
Ltn1	A	G	16: 87,381,503	S1613P	possibly damaging	Het
Mtmr4	T	A	11: 87,612,050	W920R	probably damaging	Het
Nbeal1	T	C	1: 60,228,791		probably benign	Het
Nup133	A	G	8: 123,916,299	Y761H	possibly damaging	Het
Nwd2	T	A	5: 63,805,983	V970D	probably damaging	Het
Olfr1058	A	T	2: 86,385,874	S181R	probably damaging	Het
Olfr1261	A	G	2: 89,993,957	H188R	probably benign	Het
Olfr429	T	C	1: 174,089,219	Y60H	probably benign	Het
Osbp	C	T	19: 11,973,876	L262F	probably damaging	Het
Phldb2	G	T	16: 45,825,188	D343E	probably damaging	Het
Phrf1	T	A	7: 141,260,540	M1216K	possibly damaging	Het
Phyh	A	T	2: 4,930,651		probably null	Het
Plekhf1	A	T	7: 38,222,170		probably null	Het
Rars	T	C	11: 35,828,648	N116D	probably damaging	Het
Rnf44	T	A	13: 54,682,808	Q181L	possibly damaging	Het
Rpe65	T	C	3: 159,615,682		probably null	Het
Scaf1	A	G	7: 45,013,592		probably benign	Het
Serpinb11	A	T	1: 107,372,189	R88S	probably benign	Het
Slc7a7	T	C	14: 54,379,103	N174S	probably damaging	Het
Slc9a5	T	C	8: 105,357,175		probably null	Het
Slfn1	C	A	11: 83,121,176	N39K	possibly damaging	Het
Snx20	G	A	8: 88,627,295	A269V	possibly damaging	Het
Snx6	A	G	12: 54,754,319	Y298H	probably damaging	Het
Stk32c	C	T	7: 139,120,674	R213Q	probably benign	Het
Tgfbr1	A	T	4: 47,396,555	I190F	probably damaging	Het
Ube2d2b	T	A	5: 107,830,632	F50I	probably damaging	Het
Ubl5	G	A	9: 20,646,534		probably benign	Het
Ubqln5	T	G	7: 104,128,574	T348P	possibly damaging	Het
Usp46	T	C	5: 74,037,085	D22G	probably benign	Het
Vars	A	G	17: 35,012,376	N655S	probably damaging	Het
Vmn2r103	A	C	17: 19,812,453	I830L	possibly damaging	Het
Vmn2r26	T	A	6: 124,039,871	N431K	probably benign	Het
Vmn2r4	G	T	3: 64,391,066	P547Q	probably damaging	Het
Yy1	T	A	12: 108,806,428		probably benign	Het
Zbtb2	A	T	10: 4,368,592	L478Q	possibly damaging	Het
Zfp12	T	C	5: 143,239,988	F17S	probably damaging	Het
Zfp219	T	A	14: 52,007,149		probably null	Het
Zfp629	G	A	7: 127,610,370	H756Y	probably damaging	Het
Zfp748	T	C	13: 67,541,173	K656R	possibly damaging	Het
Zfp958	T	A	8: 4,629,072	Y366N	probably benign	Het
Zp3	C	T	5: 135,988,523	T396I	probably benign	Het

Other mutations in Dopey2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00476:Dopey2	APN	16	93800026	unclassified	probably benign
IGL00492:Dopey2	APN	16	93780782	missense	probably benign	0.00
IGL00753:Dopey2	APN	16	93769624	missense	probably benign
IGL00832:Dopey2	APN	16	93763401	missense	probably benign	0.01
IGL00939:Dopey2	APN	16	93774083	missense	possibly damaging	0.83
IGL01019:Dopey2	APN	16	93810229	missense	probably benign	0.32
IGL01288:Dopey2	APN	16	93739293	missense	possibly damaging	0.78
IGL01505:Dopey2	APN	16	93757116	missense	possibly damaging	0.87
IGL01535:Dopey2	APN	16	93769958	nonsense	probably null
IGL01696:Dopey2	APN	16	93770240	missense	probably benign	0.00
IGL02077:Dopey2	APN	16	93780760	missense	probably damaging	0.96
IGL02163:Dopey2	APN	16	93762427	missense	possibly damaging	0.48
IGL02234:Dopey2	APN	16	93752151	missense	probably benign
IGL02302:Dopey2	APN	16	93810117	missense	probably benign	0.08
IGL02485:Dopey2	APN	16	93770822	missense	probably damaging	1.00
IGL02563:Dopey2	APN	16	93777405	missense	probably damaging	0.99
IGL02733:Dopey2	APN	16	93739191	missense	possibly damaging	0.80
IGL02792:Dopey2	APN	16	93801572	missense	possibly damaging	0.75
IGL02941:Dopey2	APN	16	93755473	missense	probably benign	0.09
IGL03143:Dopey2	APN	16	93759655	missense	probably benign
PIT4519001:Dopey2	UTSW	16	93762054	missense	probably benign
R0320:Dopey2	UTSW	16	93810147	missense	probably benign	0.02
R0499:Dopey2	UTSW	16	93770437	missense	probably benign	0.00
R0501:Dopey2	UTSW	16	93752862	missense	probably benign	0.00
R0534:Dopey2	UTSW	16	93762505	missense	probably benign	0.04
R0583:Dopey2	UTSW	16	93755486	missense	probably benign	0.30
R0626:Dopey2	UTSW	16	93763956	missense	probably damaging	1.00
R0724:Dopey2	UTSW	16	93762325	missense	probably benign	0.01
R0907:Dopey2	UTSW	16	93801593	missense	probably damaging	1.00
R1263:Dopey2	UTSW	16	93777386	missense	probably benign
R1378:Dopey2	UTSW	16	93770392	missense	probably benign
R1572:Dopey2	UTSW	16	93770153	missense	probably damaging	1.00
R1604:Dopey2	UTSW	16	93762570	missense	probably benign
R1642:Dopey2	UTSW	16	93762315	missense	probably benign	0.00
R1668:Dopey2	UTSW	16	93765516	missense	probably damaging	1.00
R1669:Dopey2	UTSW	16	93769660	missense	probably damaging	1.00
R1702:Dopey2	UTSW	16	93747621	missense	possibly damaging	0.47
R1711:Dopey2	UTSW	16	93799926	missense	probably damaging	1.00
R1917:Dopey2	UTSW	16	93716262	missense	probably damaging	1.00
R1968:Dopey2	UTSW	16	93782419	missense	probably damaging	1.00
R1988:Dopey2	UTSW	16	93766173	missense	probably damaging	1.00
R2029:Dopey2	UTSW	16	93769435	missense	probably benign	0.36
R2139:Dopey2	UTSW	16	93771007	missense	possibly damaging	0.78
R2355:Dopey2	UTSW	16	93770677	missense	probably damaging	1.00
R3609:Dopey2	UTSW	16	93739332	missense	probably damaging	1.00
R3792:Dopey2	UTSW	16	93771846	missense	possibly damaging	0.54
R4364:Dopey2	UTSW	16	93770924	missense	probably benign	0.00
R4380:Dopey2	UTSW	16	93716232	missense	possibly damaging	0.53
R4455:Dopey2	UTSW	16	93766215	missense	probably damaging	1.00
R4779:Dopey2	UTSW	16	93757081	missense	probably damaging	1.00
R4820:Dopey2	UTSW	16	93793090	missense	probably benign	0.00
R4834:Dopey2	UTSW	16	93740004	start codon destroyed	probably null	0.70
R4866:Dopey2	UTSW	16	93763430	critical splice donor site	probably null
R4882:Dopey2	UTSW	16	93752914	missense	possibly damaging	0.95
R4900:Dopey2	UTSW	16	93763430	critical splice donor site	probably null
R5153:Dopey2	UTSW	16	93774003	missense	probably damaging	0.98
R5176:Dopey2	UTSW	16	93740043	missense	probably damaging	1.00
R5206:Dopey2	UTSW	16	93801584	missense	probably damaging	1.00
R5320:Dopey2	UTSW	16	93739986	missense	probably damaging	1.00
R5361:Dopey2	UTSW	16	93770504	missense	probably damaging	1.00
R5380:Dopey2	UTSW	16	93763410	missense	probably damaging	0.96
R5476:Dopey2	UTSW	16	93773913	splice site	probably null
R5502:Dopey2	UTSW	16	93793226	missense	probably benign	0.00
R5543:Dopey2	UTSW	16	93798920	missense	probably damaging	0.98
R5557:Dopey2	UTSW	16	93763931	missense	probably damaging	0.96
R5901:Dopey2	UTSW	16	93769751	missense	possibly damaging	0.88
R6174:Dopey2	UTSW	16	93766222	missense	probably damaging	1.00
R6256:Dopey2	UTSW	16	93807214	missense	possibly damaging	0.94
R6383:Dopey2	UTSW	16	93782248	missense	possibly damaging	0.76
R6525:Dopey2	UTSW	16	93809416	missense	probably damaging	1.00
R6554:Dopey2	UTSW	16	93760458	missense	probably benign	0.22
R6823:Dopey2	UTSW	16	93755485	missense	possibly damaging	0.75
R7036:Dopey2	UTSW	16	93777490	missense	probably benign	0.01
R7058:Dopey2	UTSW	16	93776990	missense	probably benign	0.00
R7061:Dopey2	UTSW	16	93762063	missense	probably benign	0.00
R7209:Dopey2	UTSW	16	93769845	missense	probably benign
R7214:Dopey2	UTSW	16	93810135	missense	possibly damaging	0.69
R7232:Dopey2	UTSW	16	93760485	critical splice donor site	probably null
R7255:Dopey2	UTSW	16	93770146	missense	probably damaging	1.00
R7335:Dopey2	UTSW	16	93747508	missense	probably benign	0.04
R7535:Dopey2	UTSW	16	93806361	missense	probably damaging	1.00
R7700:Dopey2	UTSW	16	93798761	splice site	probably null
R7763:Dopey2	UTSW	16	93755514	missense	probably benign	0.00
R7814:Dopey2	UTSW	16	93799971	missense	probably damaging	1.00
R7839:Dopey2	UTSW	16	93763941	missense	probably damaging	1.00
R7862:Dopey2	UTSW	16	93749963	missense	probably damaging	1.00
R7894:Dopey2	UTSW	16	93810204	missense	probably benign	0.01
R7952:Dopey2	UTSW	16	93749960	missense	possibly damaging	0.93
R7956:Dopey2	UTSW	16	93771028	critical splice donor site	probably null
R8033:Dopey2	UTSW	16	93769483	missense	probably benign
R8061:Dopey2	UTSW	16	93749996	missense	probably damaging	1.00
R8067:Dopey2	UTSW	16	93765448	nonsense	probably null
R8146:Dopey2	UTSW	16	93749939	missense	possibly damaging	0.95
R8184:Dopey2	UTSW	16	93776993	missense	probably benign	0.13
R8221:Dopey2	UTSW	16	93749959	missense	probably benign	0.01
R8263:Dopey2	UTSW	16	93762195	missense	possibly damaging	0.87
R8329:Dopey2	UTSW	16	93771787	missense	probably damaging	1.00
R8555:Dopey2	UTSW	16	93771810	missense	probably damaging	1.00
R8683:Dopey2	UTSW	16	93771811	missense	probably damaging	0.98
R8683:Dopey2	UTSW	16	93773921	missense	probably benign
R8716:Dopey2	UTSW	16	93780785	nonsense	probably null
R8807:Dopey2	UTSW	16	93762085	missense	probably benign	0.03
R8840:Dopey2	UTSW	16	93810117	missense	probably benign	0.08
R8851:Dopey2	UTSW	16	93762510	missense	probably benign	0.39
R8884:Dopey2	UTSW	16	93759662	missense	probably benign
R8976:Dopey2	UTSW	16	93762081	missense	probably benign	0.01
R9219:Dopey2	UTSW	16	93770296	missense	probably damaging	1.00
R9238:Dopey2	UTSW	16	93749130	missense	probably benign	0.14
R9284:Dopey2	UTSW	16	93760308	missense	probably damaging	1.00
R9289:Dopey2	UTSW	16	93771793	missense	probably damaging	1.00
R9298:Dopey2	UTSW	16	93800199	missense	probably damaging	0.96
R9338:Dopey2	UTSW	16	93803560	missense	probably damaging	1.00
R9346:Dopey2	UTSW	16	93780814	critical splice donor site	probably null
R9444:Dopey2	UTSW	16	93810239	missense	probably benign	0.00
R9500:Dopey2	UTSW	16	93810283	missense	probably benign
R9601:Dopey2	UTSW	16	93747643	missense	possibly damaging	0.87
R9793:Dopey2	UTSW	16	93801615	missense	probably benign	0.30
Z1088:Dopey2	UTSW	16	93763326	missense	probably benign	0.00
Z1176:Dopey2	UTSW	16	93769581	missense	probably benign	0.00
Z1176:Dopey2	UTSW	16	93803546	missense	probably damaging	1.00
Z1176:Dopey2	UTSW	16	93807868	missense	possibly damaging	0.82
Z1177:Dopey2	UTSW	16	93763895	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGCTGACAAATTCTGGAGAGC -3'
(R):5'- ACTCAGCACCTCAGAAGTCTG -3'

Sequencing Primer
(F):5'- TGTCATCCTCCATTGAGAGACAGG -3'
(R):5'- AAGTCTGACATGGCGGGCTG -3'

Posted On

2017-02-28