Incidental Mutation 'R5931:Ep400'
ID 461833
Institutional Source Beutler Lab
Gene Symbol Ep400
Ensembl Gene ENSMUSG00000029505
Gene Name E1A binding protein p400
Synonyms mDomino, 1700020J09Rik, p400
MMRRC Submission 044126-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5931 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 110664373-110770717 bp(-) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) A to G at 110735520 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138369 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041558] [ENSMUST00000112433] [ENSMUST00000112435] [ENSMUST00000112436] [ENSMUST00000146458]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000041558
AA Change: S683P
SMART Domains Protein: ENSMUSP00000049038
Gene: ENSMUSG00000029505
AA Change: S683P

DomainStartEndE-ValueType
Pfam:EP400_N 1 461 1.6e-232 PFAM
low complexity region 519 532 N/A INTRINSIC
low complexity region 550 561 N/A INTRINSIC
low complexity region 598 620 N/A INTRINSIC
low complexity region 631 645 N/A INTRINSIC
low complexity region 658 686 N/A INTRINSIC
HSA 762 833 1.31e-31 SMART
low complexity region 908 925 N/A INTRINSIC
DEXDc 1049 1238 2.76e-15 SMART
Blast:DEXDc 1276 1317 2e-15 BLAST
low complexity region 1407 1417 N/A INTRINSIC
HELICc 1807 1893 1.17e-4 SMART
low complexity region 2006 2019 N/A INTRINSIC
low complexity region 2080 2100 N/A INTRINSIC
low complexity region 2214 2223 N/A INTRINSIC
SANT 2243 2310 3.57e-1 SMART
low complexity region 2402 2489 N/A INTRINSIC
low complexity region 2596 2608 N/A INTRINSIC
low complexity region 2644 2679 N/A INTRINSIC
low complexity region 2694 2738 N/A INTRINSIC
low complexity region 2769 2806 N/A INTRINSIC
low complexity region 2846 2883 N/A INTRINSIC
low complexity region 2933 2947 N/A INTRINSIC
low complexity region 2974 2986 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112433
SMART Domains Protein: ENSMUSP00000108052
Gene: ENSMUSG00000029505

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
low complexity region 121 145 N/A INTRINSIC
low complexity region 262 287 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 313 329 N/A INTRINSIC
coiled coil region 418 447 N/A INTRINSIC
low complexity region 471 485 N/A INTRINSIC
low complexity region 556 569 N/A INTRINSIC
low complexity region 587 598 N/A INTRINSIC
low complexity region 635 657 N/A INTRINSIC
low complexity region 666 677 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000112435
AA Change: S720P
SMART Domains Protein: ENSMUSP00000108054
Gene: ENSMUSG00000029505
AA Change: S720P

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
low complexity region 121 145 N/A INTRINSIC
low complexity region 262 287 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 313 329 N/A INTRINSIC
coiled coil region 418 447 N/A INTRINSIC
low complexity region 471 485 N/A INTRINSIC
low complexity region 556 569 N/A INTRINSIC
low complexity region 587 598 N/A INTRINSIC
low complexity region 635 657 N/A INTRINSIC
low complexity region 668 682 N/A INTRINSIC
low complexity region 695 723 N/A INTRINSIC
HSA 799 870 1.31e-31 SMART
low complexity region 945 962 N/A INTRINSIC
DEXDc 1086 1275 2.76e-15 SMART
Blast:DEXDc 1313 1354 2e-15 BLAST
low complexity region 1444 1454 N/A INTRINSIC
internal_repeat_1 1556 1646 6.82e-5 PROSPERO
low complexity region 1887 1900 N/A INTRINSIC
low complexity region 1961 1981 N/A INTRINSIC
low complexity region 2095 2104 N/A INTRINSIC
SANT 2124 2191 3.57e-1 SMART
low complexity region 2283 2370 N/A INTRINSIC
internal_repeat_1 2371 2463 6.82e-5 PROSPERO
low complexity region 2477 2489 N/A INTRINSIC
low complexity region 2525 2560 N/A INTRINSIC
low complexity region 2575 2619 N/A INTRINSIC
low complexity region 2645 2659 N/A INTRINSIC
low complexity region 2660 2680 N/A INTRINSIC
low complexity region 2720 2757 N/A INTRINSIC
low complexity region 2807 2821 N/A INTRINSIC
low complexity region 2848 2860 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000112436
AA Change: S647P
SMART Domains Protein: ENSMUSP00000108055
Gene: ENSMUSG00000029505
AA Change: S647P

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
low complexity region 121 145 N/A INTRINSIC
low complexity region 262 287 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 313 329 N/A INTRINSIC
coiled coil region 418 449 N/A INTRINSIC
low complexity region 472 482 N/A INTRINSIC
low complexity region 483 496 N/A INTRINSIC
low complexity region 514 525 N/A INTRINSIC
low complexity region 562 584 N/A INTRINSIC
low complexity region 595 609 N/A INTRINSIC
low complexity region 622 650 N/A INTRINSIC
HSA 726 797 1.31e-31 SMART
low complexity region 872 889 N/A INTRINSIC
DEXDc 1013 1202 2.76e-15 SMART
Blast:DEXDc 1240 1281 2e-15 BLAST
low complexity region 1371 1381 N/A INTRINSIC
internal_repeat_1 1483 1573 6.76e-5 PROSPERO
HELICc 1771 1857 1.17e-4 SMART
low complexity region 1970 1983 N/A INTRINSIC
low complexity region 2044 2064 N/A INTRINSIC
low complexity region 2178 2187 N/A INTRINSIC
SANT 2207 2274 3.57e-1 SMART
low complexity region 2366 2453 N/A INTRINSIC
internal_repeat_1 2454 2546 6.76e-5 PROSPERO
low complexity region 2560 2572 N/A INTRINSIC
low complexity region 2608 2643 N/A INTRINSIC
low complexity region 2658 2702 N/A INTRINSIC
low complexity region 2733 2770 N/A INTRINSIC
low complexity region 2810 2847 N/A INTRINSIC
low complexity region 2897 2911 N/A INTRINSIC
low complexity region 2938 2950 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146458
SMART Domains Protein: ENSMUSP00000138369
Gene: ENSMUSG00000029505

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
low complexity region 121 145 N/A INTRINSIC
low complexity region 262 287 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 313 329 N/A INTRINSIC
coiled coil region 418 449 N/A INTRINSIC
low complexity region 519 532 N/A INTRINSIC
low complexity region 550 561 N/A INTRINSIC
low complexity region 598 620 N/A INTRINSIC
low complexity region 629 640 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele die at E11.5 and display severe defects in yolk sac erythropoiesis, anemia, and a slight deformity of the neural tube. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik G A 2: 130,814,189 T2M probably damaging Het
4930590J08Rik A T 6: 91,919,115 R315W probably damaging Het
Atrn A T 2: 130,933,436 Y153F possibly damaging Het
C4b A G 17: 34,729,193 V1644A probably damaging Het
Carmil3 A C 14: 55,498,940 K654T probably damaging Het
Cdh1 T C 8: 106,666,332 probably null Het
Chrna1 C T 2: 73,568,100 V332M probably benign Het
Clca2 A C 3: 145,092,125 V193G possibly damaging Het
Cyld A G 8: 88,729,842 probably null Het
Dbt A T 3: 116,523,425 E83D possibly damaging Het
Deup1 T C 9: 15,561,322 R471G possibly damaging Het
Dgcr2 T A 16: 17,857,309 I188F possibly damaging Het
Dgkg G A 16: 22,558,038 R524* probably null Het
Dnah5 A T 15: 28,453,279 R4399W probably damaging Het
Egflam G A 15: 7,243,857 T579I possibly damaging Het
Eif2b2 C T 12: 85,222,787 T211I probably damaging Het
Ermp1 C G 19: 29,615,729 A788P probably benign Het
Ern1 A G 11: 106,426,873 S142P possibly damaging Het
Fbxo15 T A 18: 84,981,125 C351S probably damaging Het
Fndc3a A T 14: 72,568,867 S444T probably benign Het
Gabra6 G A 11: 42,307,441 T384M probably benign Het
Gm6169 A G 13: 97,099,197 L14S probably benign Het
Gpbp1l1 T C 4: 116,590,260 V379A probably benign Het
Hook2 G T 8: 84,995,746 E305* probably null Het
Hoxa3 G A 6: 52,172,588 A21V probably damaging Het
Hs1bp3 C A 12: 8,341,915 P339Q probably benign Het
Igha T A 12: 113,260,090 T49S probably benign Het
Klra4 C T 6: 130,053,053 V190M possibly damaging Het
Lats2 A G 14: 57,696,131 L843P probably damaging Het
Lcmt1 A G 7: 123,421,616 T255A probably benign Het
Lpar6 A G 14: 73,238,928 I110V probably damaging Het
Lrrtm4 A G 6: 80,021,739 I44V probably damaging Het
Mcm3ap T C 10: 76,471,166 V371A probably benign Het
Muc20 A T 16: 32,794,574 D144E possibly damaging Het
Nphp3 T A 9: 104,020,746 D417E probably damaging Het
Olfr853 A T 9: 19,537,333 I199K probably benign Het
Olfr889 A G 9: 38,116,374 I193V probably benign Het
Paqr7 A C 4: 134,507,720 Y296S probably damaging Het
Pcdha4 A T 18: 36,954,755 T664S probably damaging Het
Pelo T A 13: 115,088,843 Y282F probably benign Het
Plxna2 A T 1: 194,810,870 I1818F probably damaging Het
Pnkd A G 1: 74,350,674 D319G probably benign Het
Pnmal1 C A 7: 16,960,884 N221K probably benign Het
Ppp1cb T A 5: 32,483,466 probably null Het
Prkca T G 11: 108,014,310 I201L probably benign Het
Rfx2 G A 17: 56,780,778 R538C probably damaging Het
Rph3a T C 5: 120,963,873 Q100R probably damaging Het
Rtel1 C T 2: 181,330,815 R29* probably null Het
Scel T A 14: 103,605,624 Y547* probably null Het
Sp100 C T 1: 85,679,083 P303L probably damaging Het
Stk31 A G 6: 49,469,302 S958G probably benign Het
Syne2 T A 12: 76,008,865 V4168E probably benign Het
Tenm3 A T 8: 48,646,498 S91T probably benign Het
Tmcc2 TTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGC 1: 132,357,755 probably benign Het
Tmem248 T A 5: 130,229,508 I14N probably damaging Het
Tor3a T C 1: 156,656,487 I298V probably benign Het
Trim69 A T 2: 122,178,594 K378N probably damaging Het
Ttc28 C T 5: 111,085,109 P151S possibly damaging Het
Uaca T C 9: 60,872,012 V1225A probably damaging Het
Vps4b T C 1: 106,777,335 I343V probably benign Het
Wnk4 A G 11: 101,261,221 T184A probably damaging Het
Ythdc2 T A 18: 44,872,956 I1172K possibly damaging Het
Other mutations in Ep400
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Ep400 APN 5 110687841 missense unknown
IGL00585:Ep400 APN 5 110755905 missense possibly damaging 0.70
IGL00586:Ep400 APN 5 110739594 missense probably damaging 1.00
IGL00816:Ep400 APN 5 110735490 unclassified probably benign
IGL01066:Ep400 APN 5 110668199 splice site probably benign
IGL01302:Ep400 APN 5 110742048 missense probably benign 0.00
IGL01568:Ep400 APN 5 110719495 missense unknown
IGL01833:Ep400 APN 5 110680008 missense unknown
IGL02086:Ep400 APN 5 110676943 splice site probably benign
IGL02266:Ep400 APN 5 110695297 unclassified probably benign
IGL02288:Ep400 APN 5 110683836 splice site probably benign
IGL02301:Ep400 APN 5 110674960 missense probably damaging 1.00
IGL02377:Ep400 APN 5 110720825 missense unknown
IGL02382:Ep400 APN 5 110701728 missense unknown
IGL02419:Ep400 APN 5 110697376 splice site probably null
IGL02591:Ep400 APN 5 110733772 unclassified probably benign
IGL02981:Ep400 APN 5 110756103 missense possibly damaging 0.79
IGL02981:Ep400 APN 5 110691610 splice site probably benign
IGL03173:Ep400 APN 5 110708871 unclassified probably benign
IGL03244:Ep400 APN 5 110727563 missense unknown
IGL03333:Ep400 APN 5 110703566 missense unknown
santol UTSW 5 110701671 missense unknown
PIT4243001:Ep400 UTSW 5 110735580 missense unknown
PIT4260001:Ep400 UTSW 5 110693171 nonsense probably null
R0017:Ep400 UTSW 5 110673529 missense probably damaging 1.00
R0179:Ep400 UTSW 5 110668649 missense probably damaging 0.99
R0243:Ep400 UTSW 5 110724407 splice site probably benign
R0366:Ep400 UTSW 5 110701671 missense unknown
R0508:Ep400 UTSW 5 110739508 missense probably benign 0.00
R0541:Ep400 UTSW 5 110705016 missense unknown
R0558:Ep400 UTSW 5 110685067 splice site probably benign
R0576:Ep400 UTSW 5 110711093 unclassified probably benign
R0595:Ep400 UTSW 5 110703542 missense unknown
R0671:Ep400 UTSW 5 110688196 missense unknown
R0763:Ep400 UTSW 5 110665837 missense probably damaging 1.00
R1078:Ep400 UTSW 5 110735522 unclassified probably benign
R1300:Ep400 UTSW 5 110673560 missense probably damaging 1.00
R1439:Ep400 UTSW 5 110685478 missense unknown
R1520:Ep400 UTSW 5 110691778 intron probably benign
R1529:Ep400 UTSW 5 110739445 missense probably benign 0.00
R1535:Ep400 UTSW 5 110708166 unclassified probably benign
R1560:Ep400 UTSW 5 110671106 splice site probably null
R1587:Ep400 UTSW 5 110726902 missense probably benign 0.23
R1596:Ep400 UTSW 5 110708861 unclassified probably benign
R1653:Ep400 UTSW 5 110693174 nonsense probably null
R1711:Ep400 UTSW 5 110693308 unclassified probably benign
R1774:Ep400 UTSW 5 110685491 missense unknown
R1836:Ep400 UTSW 5 110705054 missense unknown
R1905:Ep400 UTSW 5 110670948 missense probably damaging 1.00
R1917:Ep400 UTSW 5 110703575 missense unknown
R2064:Ep400 UTSW 5 110735404 unclassified probably benign
R2122:Ep400 UTSW 5 110708850 unclassified probably benign
R2144:Ep400 UTSW 5 110703518 missense unknown
R2215:Ep400 UTSW 5 110693555 unclassified probably benign
R2252:Ep400 UTSW 5 110719091 missense unknown
R2253:Ep400 UTSW 5 110719091 missense unknown
R2483:Ep400 UTSW 5 110719236 missense unknown
R2504:Ep400 UTSW 5 110668645 missense probably damaging 1.00
R2512:Ep400 UTSW 5 110708915 unclassified probably benign
R2842:Ep400 UTSW 5 110698815 nonsense probably null
R2920:Ep400 UTSW 5 110755914 missense probably damaging 1.00
R3082:Ep400 UTSW 5 110693230 unclassified probably benign
R3151:Ep400 UTSW 5 110703569 missense unknown
R3552:Ep400 UTSW 5 110729287 missense unknown
R3623:Ep400 UTSW 5 110719236 missense unknown
R3779:Ep400 UTSW 5 110691649 missense unknown
R3923:Ep400 UTSW 5 110756523 missense possibly damaging 0.55
R4062:Ep400 UTSW 5 110741981 missense probably benign 0.10
R4508:Ep400 UTSW 5 110703615 missense unknown
R4584:Ep400 UTSW 5 110733897 unclassified probably benign
R4585:Ep400 UTSW 5 110753859 missense probably damaging 1.00
R4586:Ep400 UTSW 5 110753859 missense probably damaging 1.00
R4807:Ep400 UTSW 5 110695578 splice site probably null
R4921:Ep400 UTSW 5 110665810 missense probably damaging 1.00
R4976:Ep400 UTSW 5 110698812 missense unknown
R4976:Ep400 UTSW 5 110720756 missense unknown
R5075:Ep400 UTSW 5 110685485 missense unknown
R5120:Ep400 UTSW 5 110756358 missense probably damaging 1.00
R5122:Ep400 UTSW 5 110668170 missense probably damaging 1.00
R5223:Ep400 UTSW 5 110668630 missense probably damaging 1.00
R5284:Ep400 UTSW 5 110668124 missense probably damaging 1.00
R5388:Ep400 UTSW 5 110701728 missense unknown
R5401:Ep400 UTSW 5 110683171 missense unknown
R5431:Ep400 UTSW 5 110676554 missense unknown
R5461:Ep400 UTSW 5 110676684 nonsense probably null
R5568:Ep400 UTSW 5 110756205 missense probably damaging 1.00
R5650:Ep400 UTSW 5 110695952 critical splice donor site probably null
R5778:Ep400 UTSW 5 110719584 missense unknown
R5806:Ep400 UTSW 5 110755554 nonsense probably null
R5814:Ep400 UTSW 5 110695578 splice site probably null
R5830:Ep400 UTSW 5 110683996 missense unknown
R5882:Ep400 UTSW 5 110755587 missense probably benign 0.00
R5945:Ep400 UTSW 5 110682866 missense unknown
R5966:Ep400 UTSW 5 110676900 missense unknown
R5973:Ep400 UTSW 5 110729831 missense unknown
R5980:Ep400 UTSW 5 110733729 unclassified probably benign
R6000:Ep400 UTSW 5 110683201 missense unknown
R6006:Ep400 UTSW 5 110704959 missense unknown
R6053:Ep400 UTSW 5 110755795 missense probably benign 0.22
R6145:Ep400 UTSW 5 110756703 missense possibly damaging 0.95
R6154:Ep400 UTSW 5 110755933 missense probably damaging 0.97
R6169:Ep400 UTSW 5 110741997 missense possibly damaging 0.83
R6228:Ep400 UTSW 5 110670942 missense probably damaging 1.00
R6295:Ep400 UTSW 5 110753809 missense probably benign 0.00
R6486:Ep400 UTSW 5 110697218 unclassified probably benign
R6504:Ep400 UTSW 5 110708837 unclassified probably benign
R6607:Ep400 UTSW 5 110683314 missense unknown
R6657:Ep400 UTSW 5 110693545 unclassified probably benign
R6660:Ep400 UTSW 5 110719447 nonsense probably null
R6741:Ep400 UTSW 5 110676895 missense unknown
R6933:Ep400 UTSW 5 110665862 missense probably damaging 1.00
R6937:Ep400 UTSW 5 110711152 unclassified probably benign
R7069:Ep400 UTSW 5 110668124 missense probably damaging 1.00
R7103:Ep400 UTSW 5 110733785 missense unknown
R7156:Ep400 UTSW 5 110685363 missense unknown
R7272:Ep400 UTSW 5 110755645 nonsense probably null
R7365:Ep400 UTSW 5 110719614 missense unknown
R7581:Ep400 UTSW 5 110756025 missense unknown
R7684:Ep400 UTSW 5 110697352 missense unknown
R7699:Ep400 UTSW 5 110696032 missense unknown
R7700:Ep400 UTSW 5 110696032 missense unknown
R7856:Ep400 UTSW 5 110666584 missense probably damaging 0.99
R7954:Ep400 UTSW 5 110668733 missense possibly damaging 0.46
R8098:Ep400 UTSW 5 110693251 missense unknown
R8108:Ep400 UTSW 5 110687883 missense unknown
R8260:Ep400 UTSW 5 110755612 nonsense probably null
R8293:Ep400 UTSW 5 110708892 missense unknown
R8314:Ep400 UTSW 5 110755753 missense unknown
R8351:Ep400 UTSW 5 110739334 missense probably damaging 1.00
R8424:Ep400 UTSW 5 110693278 missense unknown
R8459:Ep400 UTSW 5 110708891 missense unknown
R8529:Ep400 UTSW 5 110719236 missense unknown
R8688:Ep400 UTSW 5 110720819 missense unknown
R8744:Ep400 UTSW 5 110742059 missense unknown
R8923:Ep400 UTSW 5 110683998 missense unknown
R9005:Ep400 UTSW 5 110711093 missense unknown
R9087:Ep400 UTSW 5 110667564 nonsense probably null
R9146:Ep400 UTSW 5 110701769 nonsense probably null
R9383:Ep400 UTSW 5 110685485 missense unknown
R9479:Ep400 UTSW 5 110729864 missense unknown
R9496:Ep400 UTSW 5 110707987 missense unknown
R9582:Ep400 UTSW 5 110676449 critical splice donor site probably null
R9607:Ep400 UTSW 5 110683939 missense unknown
R9712:Ep400 UTSW 5 110756643 missense unknown
R9746:Ep400 UTSW 5 110742006 missense unknown
X0012:Ep400 UTSW 5 110673196 small deletion probably benign
X0021:Ep400 UTSW 5 110682864 missense unknown
Z1176:Ep400 UTSW 5 110756635 missense unknown
Z1177:Ep400 UTSW 5 110683364 missense unknown
Z1177:Ep400 UTSW 5 110733743 missense unknown
Z1188:Ep400 UTSW 5 110755683 missense unknown
Predicted Primers PCR Primer
(F):5'- GCCTAGGAAATAAGGAGATCCCC -3'
(R):5'- CTGTAGAAGCCTTGTCCTGAC -3'

Sequencing Primer
(F):5'- TAGGAAATAAGGAGATCCCCAAACC -3'
(R):5'- AAGCCTTGTCCTGACCCTGATTC -3'
Posted On 2017-02-28