Incidental Mutation 'R5957:Snx14'
ID471228
Institutional Source Beutler Lab
Gene Symbol Snx14
Ensembl Gene ENSMUSG00000032422
Gene Namesorting nexin 14
SynonymsC330035N22Rik, YR-14
MMRRC Submission 043246-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5957 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location88376750-88438958 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88403274 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 446 (I446V)
Ref Sequence ENSEMBL: ENSMUSP00000130116 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000126405] [ENSMUST00000165315] [ENSMUST00000173011] [ENSMUST00000173039] [ENSMUST00000174806]
Predicted Effect probably benign
Transcript: ENSMUST00000126405
SMART Domains Protein: ENSMUSP00000116773
Gene: ENSMUSG00000032422

DomainStartEndE-ValueType
transmembrane domain 57 76 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
Pfam:PXA 157 210 3.9e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140439
Predicted Effect possibly damaging
Transcript: ENSMUST00000165315
AA Change: I446V

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000130116
Gene: ENSMUSG00000032422
AA Change: I446V

DomainStartEndE-ValueType
transmembrane domain 54 73 N/A INTRINSIC
transmembrane domain 75 97 N/A INTRINSIC
Pfam:PXA 157 330 8.2e-49 PFAM
Pfam:RGS 363 495 4.3e-13 PFAM
PX 585 704 8.77e-13 SMART
low complexity region 771 785 N/A INTRINSIC
Pfam:Nexin_C 825 930 2e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000173011
AA Change: I446V

PolyPhen 2 Score 0.672 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000133507
Gene: ENSMUSG00000032422
AA Change: I446V

DomainStartEndE-ValueType
transmembrane domain 54 73 N/A INTRINSIC
transmembrane domain 75 97 N/A INTRINSIC
Pfam:PXA 157 330 3.1e-49 PFAM
Pfam:RGS 363 482 3.1e-9 PFAM
low complexity region 499 513 N/A INTRINSIC
Pfam:Nexin_C 553 658 7.2e-29 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000173039
AA Change: I402V

PolyPhen 2 Score 0.688 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000133624
Gene: ENSMUSG00000032422
AA Change: I402V

DomainStartEndE-ValueType
transmembrane domain 54 73 N/A INTRINSIC
transmembrane domain 75 97 N/A INTRINSIC
Pfam:PXA 154 286 6.5e-33 PFAM
Pfam:RGS 319 451 2.6e-13 PFAM
PX 541 660 8.77e-13 SMART
low complexity region 727 741 N/A INTRINSIC
Pfam:Nexin_C 781 886 1.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173131
SMART Domains Protein: ENSMUSP00000134122
Gene: ENSMUSG00000092541

DomainStartEndE-ValueType
low complexity region 1 26 N/A INTRINSIC
low complexity region 30 58 N/A INTRINSIC
low complexity region 62 88 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000174806
AA Change: I446V

PolyPhen 2 Score 0.541 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000133533
Gene: ENSMUSG00000032422
AA Change: I446V

DomainStartEndE-ValueType
transmembrane domain 54 73 N/A INTRINSIC
transmembrane domain 75 97 N/A INTRINSIC
Pfam:PXA 158 327 1.9e-44 PFAM
Pfam:RGS 363 495 1.3e-13 PFAM
PX 594 713 8.77e-13 SMART
low complexity region 780 794 N/A INTRINSIC
Pfam:Nexin_C 834 938 2.8e-18 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family have a phox (PX) phosphoinositide binding domain and are involved in intracellular trafficking. The encoded protein also contains a regulator of G protein signaling (RGS) domain. Regulator of G protein signaling family members are regulatory molecules that act as GTPase activating proteins for G alpha subunits of heterotrimeric G proteins. Alternate splicing results in transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,070,161 T1704A probably benign Het
Adgrg7 T A 16: 56,773,427 N142I probably damaging Het
Aldh18a1 A T 19: 40,570,537 Y286* probably null Het
Armc4 T C 18: 7,285,706 E219G probably benign Het
Arpp21 T C 9: 112,185,686 T17A probably benign Het
Atp5s T C 12: 69,743,784 V185A probably benign Het
Bnip2 T C 9: 69,999,238 I147T probably damaging Het
Ccr8 T C 9: 120,093,827 Y3H probably damaging Het
Cenps C A 4: 149,130,201 probably benign Het
Cul7 G A 17: 46,657,757 G553S probably damaging Het
Cyp21a1 A G 17: 34,803,176 I206T probably benign Het
Dennd4b A G 3: 90,270,965 D488G probably damaging Het
Dip2b T C 15: 100,209,694 L1195P probably benign Het
Dock5 T A 14: 67,857,994 H77L probably benign Het
Fbxw13 C T 9: 109,192,666 probably null Het
Fmnl3 G A 15: 99,325,910 R302W probably damaging Het
Gbf1 G T 19: 46,246,221 probably null Het
Gm12794 T C 4: 101,941,701 F290L probably benign Het
Gm4846 T C 1: 166,486,953 I374V probably benign Het
Gsk3b C A 16: 38,193,953 P258T probably damaging Het
Igsf5 T C 16: 96,364,049 V8A probably benign Het
Il22 T A 10: 118,205,166 L59Q probably damaging Het
Ildr1 T C 16: 36,725,534 *517Q probably null Het
Iqca T A 1: 90,080,948 D450V probably damaging Het
Itga5 T C 15: 103,351,429 D647G probably benign Het
Myh7 T G 14: 54,989,078 N408T probably damaging Het
Mylk3 T C 8: 85,328,637 M564V probably damaging Het
Nsd2 T A 5: 33,855,603 M407K probably damaging Het
Oprd1 C T 4: 132,144,163 V75I probably benign Het
Poli G A 18: 70,517,440 H310Y probably benign Het
Ptch1 C T 13: 63,525,115 R755H probably damaging Het
Pygl A T 12: 70,199,720 M351K probably damaging Het
Serpinb9b T C 13: 33,039,848 L341P possibly damaging Het
Slc47a1 A G 11: 61,344,342 V555A probably benign Het
Slc8a2 C A 7: 16,145,284 T565K possibly damaging Het
Syde1 T C 10: 78,590,117 Y72C probably damaging Het
Trim37 C T 11: 87,145,551 R138C probably damaging Het
Tubgcp5 T A 7: 55,814,962 S530R probably benign Het
Vps13c T C 9: 67,954,971 S2957P probably damaging Het
Wdr41 T C 13: 94,997,187 probably null Het
Zyg11b T C 4: 108,245,013 K504E probably damaging Het
Other mutations in Snx14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00487:Snx14 APN 9 88402190 missense probably damaging 0.99
IGL00773:Snx14 APN 9 88394539 missense probably damaging 0.96
IGL00847:Snx14 APN 9 88420329 missense probably damaging 1.00
IGL01526:Snx14 APN 9 88381500 missense probably damaging 0.99
IGL01662:Snx14 APN 9 88385838 splice site probably benign
IGL01928:Snx14 APN 9 88381512 missense probably benign 0.04
IGL02225:Snx14 APN 9 88413524 missense probably damaging 0.99
IGL02498:Snx14 APN 9 88407464 missense probably damaging 1.00
IGL02585:Snx14 APN 9 88404518 missense possibly damaging 0.92
IGL02634:Snx14 APN 9 88403303 missense probably damaging 1.00
IGL03073:Snx14 APN 9 88422896 critical splice donor site probably null
R0167:Snx14 UTSW 9 88407416 missense probably damaging 1.00
R0324:Snx14 UTSW 9 88405238 critical splice donor site probably null
R0627:Snx14 UTSW 9 88394430 missense probably benign
R0862:Snx14 UTSW 9 88383996 missense possibly damaging 0.81
R0864:Snx14 UTSW 9 88383996 missense possibly damaging 0.81
R0973:Snx14 UTSW 9 88400721 critical splice donor site probably null
R0973:Snx14 UTSW 9 88400721 critical splice donor site probably null
R0974:Snx14 UTSW 9 88400721 critical splice donor site probably null
R1478:Snx14 UTSW 9 88394528 missense probably benign 0.00
R1511:Snx14 UTSW 9 88398364 nonsense probably null
R1522:Snx14 UTSW 9 88402224 missense possibly damaging 0.52
R1612:Snx14 UTSW 9 88376905 missense possibly damaging 0.81
R1634:Snx14 UTSW 9 88385739 missense probably benign 0.00
R1634:Snx14 UTSW 9 88407490 splice site probably benign
R1704:Snx14 UTSW 9 88413538 missense probably damaging 1.00
R1713:Snx14 UTSW 9 88415675 missense probably damaging 1.00
R1883:Snx14 UTSW 9 88402261 missense probably benign 0.01
R3701:Snx14 UTSW 9 88420243 splice site probably benign
R3853:Snx14 UTSW 9 88407319 splice site probably benign
R4301:Snx14 UTSW 9 88410623 missense probably damaging 1.00
R4449:Snx14 UTSW 9 88422999 missense probably benign 0.05
R4793:Snx14 UTSW 9 88394442 missense probably damaging 0.98
R4934:Snx14 UTSW 9 88398288 missense probably damaging 0.98
R5126:Snx14 UTSW 9 88382099 missense probably damaging 1.00
R5227:Snx14 UTSW 9 88398294 missense possibly damaging 0.77
R5518:Snx14 UTSW 9 88383802 missense probably damaging 1.00
R5838:Snx14 UTSW 9 88391776 missense probably damaging 1.00
R6153:Snx14 UTSW 9 88391806 missense probably damaging 1.00
R6156:Snx14 UTSW 9 88407339 missense possibly damaging 0.92
R6703:Snx14 UTSW 9 88422914 missense probably damaging 0.96
R6784:Snx14 UTSW 9 88381792 missense probably benign 0.01
R6823:Snx14 UTSW 9 88394382 missense possibly damaging 0.90
R6837:Snx14 UTSW 9 88380223 missense probably benign 0.07
R7169:Snx14 UTSW 9 88398309 missense probably damaging 0.98
R7216:Snx14 UTSW 9 88381791 missense probably damaging 0.99
R7224:Snx14 UTSW 9 88394561 missense possibly damaging 0.92
R7357:Snx14 UTSW 9 88404316 missense possibly damaging 0.49
R7738:Snx14 UTSW 9 88407474 missense probably benign 0.00
R7743:Snx14 UTSW 9 88398349 missense probably benign 0.01
R7969:Snx14 UTSW 9 88413560 missense probably damaging 1.00
R8016:Snx14 UTSW 9 88415687 missense probably damaging 0.99
R8384:Snx14 UTSW 9 88403280 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTTAACTGCTGCTGGAATGAC -3'
(R):5'- CTGCTTCTAGTTAGAATAAGAGCGTG -3'

Sequencing Primer
(F):5'- GCTCTTGCAAAGGACCAGAGTTC -3'
(R):5'- AGTTAGAATAAGAGCGTGAAGTTTTC -3'
Posted On2017-03-31