Mutagenetix > Incidental Mutation

Incidental Mutation 'R5957:Snx14'

471228

Institutional Source

Beutler Lab

Gene Symbol

Snx14

Ensembl Gene

ENSMUSG00000032422

Gene Name

sorting nexin 14

Synonyms

C330035N22Rik, YR-14

MMRRC Submission

043246-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5957 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

88376750-88438958 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 88403274 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 446 (I446V)

Ref Sequence

ENSEMBL: ENSMUSP00000130116 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000126405] [ENSMUST00000165315] [ENSMUST00000173011] [ENSMUST00000173039] [ENSMUST00000174806]

AlphaFold

Q8BHY8

Predicted Effect

probably benign
Transcript: ENSMUST00000126405

SMART Domains

Protein: ENSMUSP00000116773
Gene: ENSMUSG00000032422

Domain	Start	End	E-Value	Type
transmembrane domain	57	76	N/A	INTRINSIC
transmembrane domain	80	102	N/A	INTRINSIC
Pfam:PXA	157	210	3.9e-13	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140439

Predicted Effect

possibly damaging
Transcript: ENSMUST00000165315
AA Change: I446V

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000130116
Gene: ENSMUSG00000032422
AA Change: I446V

Domain	Start	End	E-Value	Type
transmembrane domain	54	73	N/A	INTRINSIC
transmembrane domain	75	97	N/A	INTRINSIC
Pfam:PXA	157	330	8.2e-49	PFAM
Pfam:RGS	363	495	4.3e-13	PFAM
PX	585	704	8.77e-13	SMART
low complexity region	771	785	N/A	INTRINSIC
Pfam:Nexin_C	825	930	2e-28	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000173011
AA Change: I446V

PolyPhen 2 Score 0.672 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000133507
Gene: ENSMUSG00000032422
AA Change: I446V

Domain	Start	End	E-Value	Type
transmembrane domain	54	73	N/A	INTRINSIC
transmembrane domain	75	97	N/A	INTRINSIC
Pfam:PXA	157	330	3.1e-49	PFAM
Pfam:RGS	363	482	3.1e-9	PFAM
low complexity region	499	513	N/A	INTRINSIC
Pfam:Nexin_C	553	658	7.2e-29	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000173039
AA Change: I402V

PolyPhen 2 Score 0.688 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000133624
Gene: ENSMUSG00000032422
AA Change: I402V

Domain	Start	End	E-Value	Type
transmembrane domain	54	73	N/A	INTRINSIC
transmembrane domain	75	97	N/A	INTRINSIC
Pfam:PXA	154	286	6.5e-33	PFAM
Pfam:RGS	319	451	2.6e-13	PFAM
PX	541	660	8.77e-13	SMART
low complexity region	727	741	N/A	INTRINSIC
Pfam:Nexin_C	781	886	1.1e-28	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000173131

SMART Domains

Protein: ENSMUSP00000134122
Gene: ENSMUSG00000092541

Domain	Start	End	E-Value	Type
low complexity region	1	26	N/A	INTRINSIC
low complexity region	30	58	N/A	INTRINSIC
low complexity region	62	88	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000174806
AA Change: I446V

PolyPhen 2 Score 0.541 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000133533
Gene: ENSMUSG00000032422
AA Change: I446V

Domain	Start	End	E-Value	Type
transmembrane domain	54	73	N/A	INTRINSIC
transmembrane domain	75	97	N/A	INTRINSIC
Pfam:PXA	158	327	1.9e-44	PFAM
Pfam:RGS	363	495	1.3e-13	PFAM
PX	594	713	8.77e-13	SMART
low complexity region	780	794	N/A	INTRINSIC
Pfam:Nexin_C	834	938	2.8e-18	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family have a phox (PX) phosphoinositide binding domain and are involved in intracellular trafficking. The encoded protein also contains a regulator of G protein signaling (RGS) domain. Regulator of G protein signaling family members are regulatory molecules that act as GTPase activating proteins for G alpha subunits of heterotrimeric G proteins. Alternate splicing results in transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2014]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	G	3: 138,070,161	T1704A	probably benign	Het
Adgrg7	T	A	16: 56,773,427	N142I	probably damaging	Het
Aldh18a1	A	T	19: 40,570,537	Y286*	probably null	Het
Armc4	T	C	18: 7,285,706	E219G	probably benign	Het
Arpp21	T	C	9: 112,185,686	T17A	probably benign	Het
Atp5s	T	C	12: 69,743,784	V185A	probably benign	Het
Bnip2	T	C	9: 69,999,238	I147T	probably damaging	Het
Ccr8	T	C	9: 120,093,827	Y3H	probably damaging	Het
Cenps	C	A	4: 149,130,201		probably benign	Het
Cul7	G	A	17: 46,657,757	G553S	probably damaging	Het
Cyp21a1	A	G	17: 34,803,176	I206T	probably benign	Het
Dennd4b	A	G	3: 90,270,965	D488G	probably damaging	Het
Dip2b	T	C	15: 100,209,694	L1195P	probably benign	Het
Dock5	T	A	14: 67,857,994	H77L	probably benign	Het
Fbxw13	C	T	9: 109,192,666		probably null	Het
Fmnl3	G	A	15: 99,325,910	R302W	probably damaging	Het
Gbf1	G	T	19: 46,246,221		probably null	Het
Gm12794	T	C	4: 101,941,701	F290L	probably benign	Het
Gm4846	T	C	1: 166,486,953	I374V	probably benign	Het
Gsk3b	C	A	16: 38,193,953	P258T	probably damaging	Het
Igsf5	T	C	16: 96,364,049	V8A	probably benign	Het
Il22	T	A	10: 118,205,166	L59Q	probably damaging	Het
Ildr1	T	C	16: 36,725,534	*517Q	probably null	Het
Iqca	T	A	1: 90,080,948	D450V	probably damaging	Het
Itga5	T	C	15: 103,351,429	D647G	probably benign	Het
Myh7	T	G	14: 54,989,078	N408T	probably damaging	Het
Mylk3	T	C	8: 85,328,637	M564V	probably damaging	Het
Nsd2	T	A	5: 33,855,603	M407K	probably damaging	Het
Oprd1	C	T	4: 132,144,163	V75I	probably benign	Het
Poli	G	A	18: 70,517,440	H310Y	probably benign	Het
Ptch1	C	T	13: 63,525,115	R755H	probably damaging	Het
Pygl	A	T	12: 70,199,720	M351K	probably damaging	Het
Serpinb9b	T	C	13: 33,039,848	L341P	possibly damaging	Het
Slc47a1	A	G	11: 61,344,342	V555A	probably benign	Het
Slc8a2	C	A	7: 16,145,284	T565K	possibly damaging	Het
Syde1	T	C	10: 78,590,117	Y72C	probably damaging	Het
Trim37	C	T	11: 87,145,551	R138C	probably damaging	Het
Tubgcp5	T	A	7: 55,814,962	S530R	probably benign	Het
Vps13c	T	C	9: 67,954,971	S2957P	probably damaging	Het
Wdr41	T	C	13: 94,997,187		probably null	Het
Zyg11b	T	C	4: 108,245,013	K504E	probably damaging	Het

Other mutations in Snx14

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00487:Snx14	APN	9	88402190	missense	probably damaging	0.99
IGL00773:Snx14	APN	9	88394539	missense	probably damaging	0.96
IGL00847:Snx14	APN	9	88420329	missense	probably damaging	1.00
IGL01526:Snx14	APN	9	88381500	missense	probably damaging	0.99
IGL01662:Snx14	APN	9	88385838	splice site	probably benign
IGL01928:Snx14	APN	9	88381512	missense	probably benign	0.04
IGL02225:Snx14	APN	9	88413524	missense	probably damaging	0.99
IGL02498:Snx14	APN	9	88407464	missense	probably damaging	1.00
IGL02585:Snx14	APN	9	88404518	missense	possibly damaging	0.92
IGL02634:Snx14	APN	9	88403303	missense	probably damaging	1.00
IGL03073:Snx14	APN	9	88422896	critical splice donor site	probably null
R0167:Snx14	UTSW	9	88407416	missense	probably damaging	1.00
R0324:Snx14	UTSW	9	88405238	critical splice donor site	probably null
R0627:Snx14	UTSW	9	88394430	missense	probably benign
R0862:Snx14	UTSW	9	88383996	missense	possibly damaging	0.81
R0864:Snx14	UTSW	9	88383996	missense	possibly damaging	0.81
R0973:Snx14	UTSW	9	88400721	critical splice donor site	probably null
R0973:Snx14	UTSW	9	88400721	critical splice donor site	probably null
R0974:Snx14	UTSW	9	88400721	critical splice donor site	probably null
R1478:Snx14	UTSW	9	88394528	missense	probably benign	0.00
R1511:Snx14	UTSW	9	88398364	nonsense	probably null
R1522:Snx14	UTSW	9	88402224	missense	possibly damaging	0.52
R1612:Snx14	UTSW	9	88376905	missense	possibly damaging	0.81
R1634:Snx14	UTSW	9	88385739	missense	probably benign	0.00
R1634:Snx14	UTSW	9	88407490	splice site	probably benign
R1704:Snx14	UTSW	9	88413538	missense	probably damaging	1.00
R1713:Snx14	UTSW	9	88415675	missense	probably damaging	1.00
R1883:Snx14	UTSW	9	88402261	missense	probably benign	0.01
R3701:Snx14	UTSW	9	88420243	splice site	probably benign
R3853:Snx14	UTSW	9	88407319	splice site	probably benign
R4301:Snx14	UTSW	9	88410623	missense	probably damaging	1.00
R4449:Snx14	UTSW	9	88422999	missense	probably benign	0.05
R4793:Snx14	UTSW	9	88394442	missense	probably damaging	0.98
R4934:Snx14	UTSW	9	88398288	missense	probably damaging	0.98
R5126:Snx14	UTSW	9	88382099	missense	probably damaging	1.00
R5227:Snx14	UTSW	9	88398294	missense	possibly damaging	0.77
R5518:Snx14	UTSW	9	88383802	missense	probably damaging	1.00
R5838:Snx14	UTSW	9	88391776	missense	probably damaging	1.00
R6153:Snx14	UTSW	9	88391806	missense	probably damaging	1.00
R6156:Snx14	UTSW	9	88407339	missense	possibly damaging	0.92
R6703:Snx14	UTSW	9	88422914	missense	probably damaging	0.96
R6784:Snx14	UTSW	9	88381792	missense	probably benign	0.01
R6823:Snx14	UTSW	9	88394382	missense	possibly damaging	0.90
R6837:Snx14	UTSW	9	88380223	missense	probably benign	0.07
R7169:Snx14	UTSW	9	88398309	missense	probably damaging	0.98
R7216:Snx14	UTSW	9	88381791	missense	probably damaging	0.99
R7224:Snx14	UTSW	9	88394561	missense	possibly damaging	0.92
R7357:Snx14	UTSW	9	88404316	missense	possibly damaging	0.49
R7738:Snx14	UTSW	9	88407474	missense	probably benign	0.00
R7743:Snx14	UTSW	9	88398349	missense	probably benign	0.01
R7969:Snx14	UTSW	9	88413560	missense	probably damaging	1.00
R8016:Snx14	UTSW	9	88415687	missense	probably damaging	0.99
R8384:Snx14	UTSW	9	88403280	nonsense	probably null
R8492:Snx14	UTSW	9	88381816	missense	possibly damaging	0.94
R8686:Snx14	UTSW	9	88415693	missense	probably damaging	1.00
R8738:Snx14	UTSW	9	88407400	missense	possibly damaging	0.93
R8870:Snx14	UTSW	9	88413488	missense	probably benign	0.01
R9208:Snx14	UTSW	9	88383779	missense	probably benign	0.01
R9402:Snx14	UTSW	9	88407437	missense	probably damaging	1.00
R9620:Snx14	UTSW	9	88381741	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTTAACTGCTGCTGGAATGAC -3'
(R):5'- CTGCTTCTAGTTAGAATAAGAGCGTG -3'

Sequencing Primer
(F):5'- GCTCTTGCAAAGGACCAGAGTTC -3'
(R):5'- AGTTAGAATAAGAGCGTGAAGTTTTC -3'

Posted On

2017-03-31