Incidental Mutation 'R6158:Mastl'
ID489675
Institutional Source Beutler Lab
Gene Symbol Mastl
Ensembl Gene ENSMUSG00000026779
Gene Namemicrotubule associated serine/threonine kinase-like
Synonyms2700091H24Rik, THC2
MMRRC Submission 044305-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6158 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location23115606-23156024 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 23132772 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 646 (N646K)
Ref Sequence ENSEMBL: ENSMUSP00000028119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028119]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028119
AA Change: N646K

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000028119
Gene: ENSMUSG00000026779
AA Change: N646K

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
Pfam:Pkinase_Tyr 34 194 2.6e-24 PFAM
Pfam:Pkinase 34 200 2.3e-39 PFAM
low complexity region 297 313 N/A INTRINSIC
Pfam:Pkinase 710 821 6.4e-19 PFAM
Pfam:Pkinase_Tyr 714 818 5.1e-6 PFAM
S_TK_X 822 864 2.01e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136207
Meta Mutation Damage Score 0.2196 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.5%
  • 20x: 92.6%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a microtubule-associated serine/threonine kinase. Mutations at this locus have been associated with autosomal dominant thrombocytopenia, also known as thrombocytopenia-2. Alternatively spliced transcript variants have been described for this locus. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality and mitotic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T C 12: 71,170,636 V793A possibly damaging Het
2900092C05Rik A G 7: 12,512,672 T32A probably benign Het
Adprhl1 C T 8: 13,224,977 V594M possibly damaging Het
Ano3 A T 2: 110,665,875 Y845N probably damaging Het
Arhgap24 A T 5: 102,892,912 I575L probably benign Het
Aurka A C 2: 172,363,596 probably null Het
C1qtnf5 A T 9: 44,108,970 probably benign Het
Cacnb2 A G 2: 14,985,601 D454G possibly damaging Het
Ccdc58 T A 16: 36,089,929 V118D probably damaging Het
Chchd5 T C 2: 129,130,517 L87P probably damaging Het
Col7a1 G T 9: 108,964,603 R1377L unknown Het
Cpne8 A C 15: 90,571,988 S191A probably damaging Het
Dhx30 A T 9: 110,087,030 I671N probably damaging Het
Dnah12 A T 14: 26,773,685 K1423N possibly damaging Het
Dnm3 T C 1: 162,320,987 M272V probably damaging Het
Fat4 A T 3: 38,983,262 S3688C possibly damaging Het
Frmpd1 A T 4: 45,285,401 L1407F probably damaging Het
Fry T C 5: 150,454,572 S410P probably damaging Het
Gm11565 T A 11: 99,914,918 C45* probably null Het
Gngt1 A T 6: 3,994,311 R30* probably null Het
Htt T C 5: 34,907,086 I2943T possibly damaging Het
Kl T A 5: 150,988,853 M689K possibly damaging Het
Lmo7 T A 14: 101,900,137 D247E probably benign Het
Mei4 G T 9: 81,927,576 L237F probably damaging Het
Mettl27 C T 5: 134,940,576 P170S possibly damaging Het
Mgam T A 6: 40,757,714 I896K probably damaging Het
Moxd1 T A 10: 24,284,777 C443S probably damaging Het
Myo18b A T 5: 112,874,172 N451K probably benign Het
Myo7b T C 18: 31,988,549 I768V probably benign Het
Nos1 A C 5: 117,867,574 I120L probably benign Het
Nsd1 T C 13: 55,245,621 V345A probably benign Het
Olfr1095 A G 2: 86,851,515 L61P possibly damaging Het
Olfr1205 T C 2: 88,831,146 F10L probably damaging Het
Olfr150 C T 9: 39,737,076 T87I probably benign Het
Olfr170 C A 16: 19,605,925 V248F probably damaging Het
Olfr344 A T 2: 36,569,116 T173S probably benign Het
Pdzph1 T G 17: 58,973,627 Q553H probably damaging Het
Piwil1 T A 5: 128,747,876 L546* probably null Het
Pla2g4f T C 2: 120,301,071 T724A probably benign Het
Ralgapa2 A T 2: 146,424,676 M660K possibly damaging Het
Rgsl1 T C 1: 153,804,021 D103G possibly damaging Het
Rnf186 A G 4: 138,967,254 D35G probably damaging Het
Rock2 A G 12: 16,954,918 D424G probably benign Het
Scg2 A T 1: 79,435,400 D495E probably damaging Het
Slc39a2 G A 14: 51,894,224 probably null Het
Snrnp48 T A 13: 38,210,236 Y100* probably null Het
Spaca1 A G 4: 34,029,176 M99T probably damaging Het
Specc1 T G 11: 62,118,124 F235L probably damaging Het
St13 A T 15: 81,399,601 probably null Het
Swap70 T A 7: 110,270,023 M341K probably damaging Het
Synj2 A G 17: 5,986,212 D67G probably benign Het
Tmem135 T A 7: 89,156,444 I251F probably benign Het
Tmem87a A T 2: 120,360,103 probably null Het
Tom1l2 C T 11: 60,232,927 D128N probably damaging Het
Tpx2 C A 2: 152,873,104 H82N probably benign Het
Trip12 A T 1: 84,761,012 C738S possibly damaging Het
Ttyh1 A G 7: 4,125,562 T153A probably benign Het
Utrn C T 10: 12,690,822 G1199S probably benign Het
Vmn1r8 T A 6: 57,036,289 N108K probably benign Het
Vmn2r63 T A 7: 42,933,680 D37V probably damaging Het
Vwce C T 19: 10,644,221 R206C possibly damaging Het
Wrn G T 8: 33,319,172 F265L probably damaging Het
Zfp472 T A 17: 32,978,389 C479* probably null Het
Zfp831 A T 2: 174,643,858 T109S possibly damaging Het
Znfx1 G T 2: 167,056,726 Q93K probably benign Het
Other mutations in Mastl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01080:Mastl APN 2 23146148 missense probably damaging 1.00
IGL02103:Mastl APN 2 23139998 missense probably benign 0.01
IGL02622:Mastl APN 2 23132845 missense probably benign 0.12
IGL02826:Mastl APN 2 23145409 missense probably damaging 1.00
IGL02896:Mastl APN 2 23131767 missense probably damaging 1.00
IGL03024:Mastl APN 2 23139919 missense probably damaging 1.00
IGL03038:Mastl APN 2 23140615 splice site probably benign
R0600:Mastl UTSW 2 23133346 missense probably benign 0.06
R0712:Mastl UTSW 2 23150993 missense probably damaging 1.00
R1168:Mastl UTSW 2 23133132 missense probably benign 0.06
R1750:Mastl UTSW 2 23146081 nonsense probably null
R1911:Mastl UTSW 2 23132680 nonsense probably null
R2051:Mastl UTSW 2 23132824 missense possibly damaging 0.49
R2859:Mastl UTSW 2 23139967 missense probably damaging 0.99
R3799:Mastl UTSW 2 23140492 splice site probably benign
R3840:Mastl UTSW 2 23140551 missense probably damaging 1.00
R4807:Mastl UTSW 2 23132843 missense probably benign
R4818:Mastl UTSW 2 23137026 missense probably benign 0.00
R4845:Mastl UTSW 2 23139998 missense probably benign 0.01
R5338:Mastl UTSW 2 23133491 missense probably benign 0.01
R5364:Mastl UTSW 2 23133653 missense probably benign 0.16
R6077:Mastl UTSW 2 23155794 missense probably damaging 0.99
R6450:Mastl UTSW 2 23120929 missense probably damaging 1.00
R6602:Mastl UTSW 2 23132677 missense probably benign 0.04
R6788:Mastl UTSW 2 23133698 missense probably benign 0.22
R6908:Mastl UTSW 2 23155976 start gained probably benign
R7058:Mastl UTSW 2 23133413 nonsense probably null
R7233:Mastl UTSW 2 23133658 missense probably benign
R7249:Mastl UTSW 2 23146139 missense probably damaging 1.00
R7347:Mastl UTSW 2 23133389 missense probably damaging 0.99
R7371:Mastl UTSW 2 23140573 missense probably damaging 1.00
R7726:Mastl UTSW 2 23140795 splice site probably null
R8057:Mastl UTSW 2 23133554 missense possibly damaging 0.75
R8288:Mastl UTSW 2 23133359 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAGCACGTGTCTTAGCAG -3'
(R):5'- TCAGGCCTTAGAACCAGATAAAAG -3'

Sequencing Primer
(F):5'- CAAGCACGTGTCTTAGCAGGTTAC -3'
(R):5'- CTACTCTTTTGAAGAACCAAACACTG -3'
Posted On2017-10-10