Mutagenetix > Incidental Mutation

Incidental Mutation 'R6908:Mastl'

538847

Institutional Source

Beutler Lab

Gene Symbol

Mastl

Ensembl Gene

ENSMUSG00000026779

Gene Name

microtubule associated serine/threonine kinase-like

Synonyms

2700091H24Rik, THC2

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6908 (G1)

Quality Score

132.008

Status

Validated

Chromosome

Chromosomal Location

23115606-23156024 bp(-) (GRCm38)

Type of Mutation

start gained

DNA Base Change (assembly)

T to C at 23155976 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000028119 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028117] [ENSMUST00000028119]

AlphaFold

Q8C0P0

Predicted Effect

probably benign
Transcript: ENSMUST00000028117

SMART Domains

Protein: ENSMUSP00000028117
Gene: ENSMUSG00000026775

Domain	Start	End	E-Value	Type
AAA	313	450	4.77e-23	SMART
Pfam:Peptidase_M41	508	706	5.8e-77	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000028119

SMART Domains

Protein: ENSMUSP00000028119
Gene: ENSMUSG00000026779

Domain	Start	End	E-Value	Type
low complexity region	2	18	N/A	INTRINSIC
Pfam:Pkinase_Tyr	34	194	2.6e-24	PFAM
Pfam:Pkinase	34	200	2.3e-39	PFAM
low complexity region	297	313	N/A	INTRINSIC
Pfam:Pkinase	710	821	6.4e-19	PFAM
Pfam:Pkinase_Tyr	714	818	5.1e-6	PFAM
S_TK_X	822	864	2.01e-1	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.2%

Validation Efficiency

95% (52/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a microtubule-associated serine/threonine kinase. Mutations at this locus have been associated with autosomal dominant thrombocytopenia, also known as thrombocytopenia-2. Alternatively spliced transcript variants have been described for this locus. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality and mitotic abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abi3bp	T	C	16: 56,657,305	I1197T	probably benign	Het
Atp2a1	A	G	7: 126,448,535		probably null	Het
B3glct	T	C	5: 149,696,476		probably null	Het
Bbs9	T	G	9: 22,567,723	I154S	probably damaging	Het
Brip1	T	C	11: 86,077,884	Y825C	probably damaging	Het
Ccdc186	A	T	19: 56,791,939		probably null	Het
Celf6	T	C	9: 59,603,823	V349A	probably benign	Het
Chd9	A	G	8: 90,956,416	T495A	probably benign	Het
Cxxc1	G	A	18: 74,220,559	C546Y	probably damaging	Het
Cxxc5	T	C	18: 35,859,215	V223A	probably damaging	Het
Dlc1	A	G	8: 36,937,687	F316S	probably benign	Het
Dnajc12	C	A	10: 63,397,325	Q82K	probably benign	Het
Dock8	G	A	19: 25,188,382	E1877K	probably damaging	Het
Epha3	T	G	16: 63,598,249	H611P	probably damaging	Het
Fpr-rs6	C	A	17: 20,182,439	C220F	probably damaging	Het
Fryl	A	G	5: 73,022,211	L2951P	probably damaging	Het
Gbp10	T	G	5: 105,221,032	T314P	probably damaging	Het
Hbb-bs	T	C	7: 103,827,534	N77D	probably benign	Het
Ints13	A	T	6: 146,555,033	D438E	probably damaging	Het
Itgb6	C	T	2: 60,650,021	V324M	probably benign	Het
Kdm7a	G	T	6: 39,144,439	L861M	possibly damaging	Het
Kirrel3	A	G	9: 35,013,401	T302A	possibly damaging	Het
Lama2	A	T	10: 27,031,196		probably null	Het
Lrp2	A	T	2: 69,472,365	C3007S	probably damaging	Het
Lypd3	G	C	7: 24,638,433	G75R	probably damaging	Het
Mcf2l	T	C	8: 13,018,919	V1087A	probably benign	Het
Mcmdc2	C	A	1: 9,930,778		probably null	Het
Ms4a3	A	G	19: 11,638,295	I39T	probably damaging	Het
Mylk	T	G	16: 34,880,273	C495G	probably benign	Het
Myo10	A	G	15: 25,804,383	D1588G	probably damaging	Het
Myo15	A	T	11: 60,506,006	T2634S	probably damaging	Het
Nlrp1b	T	C	11: 71,217,296	I460V	probably benign	Het
Nmt1	T	G	11: 103,058,254	S312A	possibly damaging	Het
Nynrin	T	G	14: 55,863,878	S335A	probably benign	Het
Olfr710	T	C	7: 106,944,632	Y123C	possibly damaging	Het
Paxip1	T	C	5: 27,791,224	Y19C	possibly damaging	Het
Pcdhb2	G	T	18: 37,296,524	A517S	probably damaging	Het
Pkd2l1	A	G	19: 44,152,446	I559T	probably damaging	Het
Plec	G	A	15: 76,185,881	Q806*	probably null	Het
Prss51	C	T	14: 64,096,152	A70V	probably benign	Het
Psd3	A	T	8: 67,964,177	I356K	probably benign	Het
Ptprn2	A	T	12: 116,888,888	I522F	probably benign	Het
Rab39	T	C	9: 53,706,069	D16G	probably damaging	Het
Ralgps1	T	C	2: 33,143,100	Q439R	probably benign	Het
Rapgef2	A	T	3: 79,104,063	D238E	probably benign	Het
Ripor2	G	A	13: 24,706,232	G697S	probably damaging	Het
Scn11a	A	T	9: 119,792,426	F642I	probably damaging	Het
Serinc4	G	A	2: 121,453,605	T310I	probably benign	Het
Sfpq	GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC	GCCGCCGCAGCAGCC	4: 127,021,626		probably benign	Het
Slc36a3	T	C	11: 55,149,886		probably benign	Het
Smc1b	A	G	15: 85,107,010	S656P	probably damaging	Het
Sorbs1	A	G	19: 40,352,332	S455P	probably damaging	Het
Ttn	C	A	2: 76,889,858		probably benign	Het
Tyw5	T	C	1: 57,401,523	R27G	probably damaging	Het
Vmn1r209	T	C	13: 22,806,230	T97A	possibly damaging	Het

Other mutations in Mastl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01080:Mastl	APN	2	23146148	missense	probably damaging	1.00
IGL02103:Mastl	APN	2	23139998	missense	probably benign	0.01
IGL02622:Mastl	APN	2	23132845	missense	probably benign	0.12
IGL02826:Mastl	APN	2	23145409	missense	probably damaging	1.00
IGL02896:Mastl	APN	2	23131767	missense	probably damaging	1.00
IGL03024:Mastl	APN	2	23139919	missense	probably damaging	1.00
IGL03038:Mastl	APN	2	23140615	splice site	probably benign
R0600:Mastl	UTSW	2	23133346	missense	probably benign	0.06
R0712:Mastl	UTSW	2	23150993	missense	probably damaging	1.00
R1168:Mastl	UTSW	2	23133132	missense	probably benign	0.06
R1750:Mastl	UTSW	2	23146081	nonsense	probably null
R1911:Mastl	UTSW	2	23132680	nonsense	probably null
R2051:Mastl	UTSW	2	23132824	missense	possibly damaging	0.49
R2859:Mastl	UTSW	2	23139967	missense	probably damaging	0.99
R3799:Mastl	UTSW	2	23140492	splice site	probably benign
R3840:Mastl	UTSW	2	23140551	missense	probably damaging	1.00
R4807:Mastl	UTSW	2	23132843	missense	probably benign
R4818:Mastl	UTSW	2	23137026	missense	probably benign	0.00
R4845:Mastl	UTSW	2	23139998	missense	probably benign	0.01
R5338:Mastl	UTSW	2	23133491	missense	probably benign	0.01
R5364:Mastl	UTSW	2	23133653	missense	probably benign	0.16
R6077:Mastl	UTSW	2	23155794	missense	probably damaging	0.99
R6158:Mastl	UTSW	2	23132772	missense	possibly damaging	0.92
R6450:Mastl	UTSW	2	23120929	missense	probably damaging	1.00
R6602:Mastl	UTSW	2	23132677	missense	probably benign	0.04
R6788:Mastl	UTSW	2	23133698	missense	probably benign	0.22
R7058:Mastl	UTSW	2	23133413	nonsense	probably null
R7233:Mastl	UTSW	2	23133658	missense	probably benign
R7249:Mastl	UTSW	2	23146139	missense	probably damaging	1.00
R7347:Mastl	UTSW	2	23133389	missense	probably damaging	0.99
R7371:Mastl	UTSW	2	23140573	missense	probably damaging	1.00
R7726:Mastl	UTSW	2	23140795	splice site	probably null
R8057:Mastl	UTSW	2	23133554	missense	possibly damaging	0.75
R8288:Mastl	UTSW	2	23133359	missense	probably damaging	1.00
R9101:Mastl	UTSW	2	23118437	makesense	probably null

Predicted Primers

PCR Primer
(F):5'- TCTTGGTACCGGGATCCTAC -3'
(R):5'- TGACTGAGACTCGGAAGGAC -3'

Sequencing Primer
(F):5'- TACCGGGATCCTACTCACG -3'
(R):5'- GACTACATAAAGTCTTAGTCCCTTGC -3'

Posted On

2018-11-06