Mutagenetix > Incidental Mutation

Incidental Mutation 'R7726:Mastl'

628487

Institutional Source

Beutler Lab

Gene Symbol

Mastl

Ensembl Gene

ENSMUSG00000026779

Gene Name

microtubule associated serine/threonine kinase-like

Synonyms

2700091H24Rik, THC2

MMRRC Submission

045782-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7726 (G1)

Quality Score

62.0073

Status

Validated

Chromosome

Chromosomal Location

23115606-23156024 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 23140795 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000028119 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028119]

AlphaFold

Q8C0P0

Predicted Effect

probably null
Transcript: ENSMUST00000028119

SMART Domains

Protein: ENSMUSP00000028119
Gene: ENSMUSG00000026779

Domain	Start	End	E-Value	Type
low complexity region	2	18	N/A	INTRINSIC
Pfam:Pkinase_Tyr	34	194	2.6e-24	PFAM
Pfam:Pkinase	34	200	2.3e-39	PFAM
low complexity region	297	313	N/A	INTRINSIC
Pfam:Pkinase	710	821	6.4e-19	PFAM
Pfam:Pkinase_Tyr	714	818	5.1e-6	PFAM
S_TK_X	822	864	2.01e-1	SMART

Meta Mutation Damage Score

0.9756

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a microtubule-associated serine/threonine kinase. Mutations at this locus have been associated with autosomal dominant thrombocytopenia, also known as thrombocytopenia-2. Alternatively spliced transcript variants have been described for this locus. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality and mitotic abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931408C20Rik	C	A	1: 26,684,498	A534S	probably benign	Het
A230050P20Rik	T	C	9: 20,873,165	Y182H	possibly damaging	Het
Adam34	T	G	8: 43,651,171	N479T	probably damaging	Het
Add3	C	G	19: 53,239,461	L526V	probably damaging	Het
Alas1	T	C	9: 106,246,951	T3A	probably benign	Het
Arap3	C	T	18: 37,989,467	D579N	probably damaging	Het
Armc6	C	A	8: 70,222,598	D326Y	probably damaging	Het
Atp6v1e2	G	A	17: 86,944,385	T195I	probably damaging	Het
Atrnl1	A	G	19: 57,702,072	E904G	probably damaging	Het
Bhlhe40	T	A	6: 108,662,598	D112E	probably benign	Het
Brf1	T	G	12: 112,964,245	K438T	probably benign	Het
Cabs1	A	T	5: 87,980,286	E265D	probably damaging	Het
Ccdc162	T	A	10: 41,553,075	M1937L	probably benign	Het
Cd55b	A	T	1: 130,411,493	S299R	possibly damaging	Het
Chordc1	A	G	9: 18,302,214	*120W	probably null	Het
Col17a1	C	A	19: 47,655,190		probably null	Het
Cpne8	A	T	15: 90,501,418	I469K	possibly damaging	Het
Crtac1	G	T	19: 42,302,251	S337*	probably null	Het
Cx3cl1	T	C	8: 94,780,239	S291P	probably damaging	Het
Dhx36	G	T	3: 62,488,968	Q423K	probably benign	Het
Eif3h	G	T	15: 51,786,823	Q322K	possibly damaging	Het
Ero1lb	A	G	13: 12,605,833	*494W	probably null	Het
Exph5	G	A	9: 53,373,175	V519I	possibly damaging	Het
Fam184a	C	A	10: 53,633,706	E126*	probably null	Het
Fam208a	C	A	14: 27,447,497	N338K	probably damaging	Het
Fam222b	A	G	11: 78,153,751	D46G	probably damaging	Het
Fbxl6	C	A	15: 76,535,886	R509L	probably damaging	Het
Fgf14	T	C	14: 124,136,244	Y86C	probably damaging	Het
Fras1	A	T	5: 96,712,451	I2119F	probably benign	Het
Gm14085	A	G	2: 122,486,733	E25G	probably damaging	Het
Gpr37	G	A	6: 25,669,117	T576I	possibly damaging	Het
Hnrnpul2	G	T	19: 8,831,280	R702L	possibly damaging	Het
Iqgap1	T	C	7: 80,757,456	N342S	probably benign	Het
Kcnh6	T	C	11: 106,017,575	V339A	probably benign	Het
Klk1b9	A	T	7: 43,978,416	N46I	possibly damaging	Het
Kndc1	C	A	7: 139,939,838	S1703R	possibly damaging	Het
Lyn	C	A	4: 3,756,428	Y306*	probably null	Het
Manba	C	T	3: 135,518,009	T219M	probably benign	Het
Med15	T	G	16: 17,655,174	M550L	possibly damaging	Het
Men1	G	A	19: 6,337,282		probably null	Het
Mettl11b	A	G	1: 163,703,184	C229R	probably benign	Het
Msh4	C	T	3: 153,866,320		probably null	Het
Myh6	G	T	14: 54,965,365	D32E	probably damaging	Het
Ntn4	A	G	10: 93,733,682	D419G	possibly damaging	Het
Nup155	C	T	15: 8,122,139	P393S	probably damaging	Het
Olfr1389	T	A	11: 49,430,900	C141*	probably null	Het
Olfr1415	A	T	1: 92,491,307	F149L	probably benign	Het
Palm2	C	T	4: 57,709,876	P274S	probably damaging	Het
Papss2	A	T	19: 32,634,003		probably null	Het
Pcdhgc3	T	C	18: 37,806,879	V111A	possibly damaging	Het
Pcnx2	C	T	8: 125,850,330	V988I	probably benign	Het
Pom121	C	T	5: 135,378,148	G1178S	probably damaging	Het
Prss33	A	G	17: 23,834,229	C213R	probably damaging	Het
Scap	G	A	9: 110,378,367		probably null	Het
Sirpb1c	T	A	3: 15,848,386	I10F	possibly damaging	Het
Spink5	T	C	18: 43,963,352	L16P	probably damaging	Het
Stk4	T	G	2: 164,110,226	M1R	probably null	Het
Stub1	A	T	17: 25,831,132	Y253*	probably null	Het
Tbce	A	G	13: 14,029,290	V29A	probably damaging	Het
Tchhl1	A	G	3: 93,471,758	R590G	probably benign	Het
Tmem173	C	T	18: 35,735,265	A261T	probably damaging	Het
Ubr4	C	T	4: 139,458,920	P613L	unknown	Het
Vmn2r3	G	T	3: 64,275,518	C253*	probably null	Het
Wfdc8	C	A	2: 164,599,986	E215D	possibly damaging	Het
Zfp874b	T	C	13: 67,473,856	D441G	probably benign	Het
Zscan4d	G	T	7: 11,165,242	P36Q	possibly damaging	Het

Other mutations in Mastl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01080:Mastl	APN	2	23146148	missense	probably damaging	1.00
IGL02103:Mastl	APN	2	23139998	missense	probably benign	0.01
IGL02622:Mastl	APN	2	23132845	missense	probably benign	0.12
IGL02826:Mastl	APN	2	23145409	missense	probably damaging	1.00
IGL02896:Mastl	APN	2	23131767	missense	probably damaging	1.00
IGL03024:Mastl	APN	2	23139919	missense	probably damaging	1.00
IGL03038:Mastl	APN	2	23140615	splice site	probably benign
R0600:Mastl	UTSW	2	23133346	missense	probably benign	0.06
R0712:Mastl	UTSW	2	23150993	missense	probably damaging	1.00
R1168:Mastl	UTSW	2	23133132	missense	probably benign	0.06
R1750:Mastl	UTSW	2	23146081	nonsense	probably null
R1911:Mastl	UTSW	2	23132680	nonsense	probably null
R2051:Mastl	UTSW	2	23132824	missense	possibly damaging	0.49
R2859:Mastl	UTSW	2	23139967	missense	probably damaging	0.99
R3799:Mastl	UTSW	2	23140492	splice site	probably benign
R3840:Mastl	UTSW	2	23140551	missense	probably damaging	1.00
R4807:Mastl	UTSW	2	23132843	missense	probably benign
R4818:Mastl	UTSW	2	23137026	missense	probably benign	0.00
R4845:Mastl	UTSW	2	23139998	missense	probably benign	0.01
R5338:Mastl	UTSW	2	23133491	missense	probably benign	0.01
R5364:Mastl	UTSW	2	23133653	missense	probably benign	0.16
R6077:Mastl	UTSW	2	23155794	missense	probably damaging	0.99
R6158:Mastl	UTSW	2	23132772	missense	possibly damaging	0.92
R6450:Mastl	UTSW	2	23120929	missense	probably damaging	1.00
R6602:Mastl	UTSW	2	23132677	missense	probably benign	0.04
R6788:Mastl	UTSW	2	23133698	missense	probably benign	0.22
R6908:Mastl	UTSW	2	23155976	start gained	probably benign
R7058:Mastl	UTSW	2	23133413	nonsense	probably null
R7233:Mastl	UTSW	2	23133658	missense	probably benign
R7249:Mastl	UTSW	2	23146139	missense	probably damaging	1.00
R7347:Mastl	UTSW	2	23133389	missense	probably damaging	0.99
R7371:Mastl	UTSW	2	23140573	missense	probably damaging	1.00
R8057:Mastl	UTSW	2	23133554	missense	possibly damaging	0.75
R8288:Mastl	UTSW	2	23133359	missense	probably damaging	1.00
R9101:Mastl	UTSW	2	23118437	makesense	probably null

Predicted Primers

PCR Primer
(F):5'- TGGTGTTGTGAGAATATCCATCATA -3'
(R):5'- GCTGATAATTAGTGAGCAAATGTTTC -3'

Sequencing Primer
(F):5'- CACATGTTCTGAACTTTGTC -3'
(R):5'- CTTGAAAAACTGATAGCATTCTGGG -3'

Posted On

2020-04-21