Incidental Mutation 'R0533:Kbtbd4'
ID 49303
Institutional Source Beutler Lab
Gene Symbol Kbtbd4
Ensembl Gene ENSMUSG00000005505
Gene Name kelch repeat and BTB (POZ) domain containing 4
Synonyms 2510026C23Rik
MMRRC Submission 038725-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.419) question?
Stock # R0533 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 90735113-90740905 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 90737948 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 233 (K233E)
Ref Sequence ENSEMBL: ENSMUSP00000107089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005647] [ENSMUST00000090682] [ENSMUST00000111464]
AlphaFold Q8R179
Predicted Effect probably benign
Transcript: ENSMUST00000005647
SMART Domains Protein: ENSMUSP00000005647
Gene: ENSMUSG00000005510

DomainStartEndE-ValueType
Pfam:Complex1_30kDa 85 207 1.9e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000077874
SMART Domains Protein: ENSMUSP00000077036
Gene: ENSMUSG00000063235

DomainStartEndE-ValueType
PTPc_DSPc 118 252 9.8e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000090682
AA Change: K217E

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000088179
Gene: ENSMUSG00000005505
AA Change: K217E

DomainStartEndE-ValueType
BTB 45 142 1.43e-25 SMART
BACK 147 239 6.08e-10 SMART
SCOP:d1k3ia3 279 467 8e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000111461
SMART Domains Protein: ENSMUSP00000107087
Gene: ENSMUSG00000063235

DomainStartEndE-ValueType
low complexity region 81 98 N/A INTRINSIC
low complexity region 114 133 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111464
AA Change: K233E

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000107089
Gene: ENSMUSG00000005505
AA Change: K233E

DomainStartEndE-ValueType
BTB 61 158 1.43e-25 SMART
BACK 163 255 6.08e-10 SMART
SCOP:d1k3ia3 295 483 9e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123426
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124284
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125001
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140945
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155621
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144683
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152059
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155372
Meta Mutation Damage Score 0.2536 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.5%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadat T G 8: 60,984,797 (GRCm39) probably benign Het
Abcb1b A T 5: 8,914,113 (GRCm39) probably null Het
Adcy10 A G 1: 165,391,592 (GRCm39) N1283S probably benign Het
Adgrb1 T A 15: 74,413,408 (GRCm39) W531R probably damaging Het
Ago4 A G 4: 126,410,653 (GRCm39) V246A probably benign Het
Arid5b A T 10: 68,021,863 (GRCm39) D242E probably damaging Het
Arpp21 A G 9: 111,955,573 (GRCm39) V522A probably benign Het
Atg4b T A 1: 93,712,632 (GRCm39) probably benign Het
Capn12 T C 7: 28,587,108 (GRCm39) F359S possibly damaging Het
Ccdc88c A T 12: 100,920,541 (GRCm39) I360N probably damaging Het
Clic3 A G 2: 25,348,150 (GRCm39) Y99C probably damaging Het
Cux1 T C 5: 136,336,713 (GRCm39) E925G probably damaging Het
Dnah10 G A 5: 124,852,314 (GRCm39) probably null Het
Dnah17 A G 11: 118,001,363 (GRCm39) V860A possibly damaging Het
Etv5 C T 16: 22,254,825 (GRCm39) probably benign Het
Fam83a T A 15: 57,873,207 (GRCm39) N345K probably benign Het
G3bp1 T C 11: 55,389,452 (GRCm39) F383L probably damaging Het
Gpm6a A G 8: 55,508,409 (GRCm39) probably null Het
Grid1 T A 14: 35,031,342 (GRCm39) Y312N possibly damaging Het
Gstm4 T C 3: 107,950,841 (GRCm39) N51S probably benign Het
Hid1 A T 11: 115,239,635 (GRCm39) I765N probably damaging Het
Hmmr A G 11: 40,600,816 (GRCm39) V518A unknown Het
Itgb6 A G 2: 60,499,541 (GRCm39) V84A probably benign Het
Kif15 A T 9: 122,838,498 (GRCm39) probably benign Het
Klre1 T C 6: 129,560,156 (GRCm39) S143P probably damaging Het
Krt81 T C 15: 101,359,270 (GRCm39) D216G probably benign Het
Mctp2 G T 7: 71,730,570 (GRCm39) H868Q probably benign Het
Morc2b G C 17: 33,354,906 (GRCm39) Y955* probably null Het
Myog A C 1: 134,218,211 (GRCm39) N140H possibly damaging Het
Myrf G C 19: 10,195,526 (GRCm39) T428S probably benign Het
Naip2 A C 13: 100,298,290 (GRCm39) I582S probably benign Het
Neil3 A T 8: 54,091,810 (GRCm39) probably null Het
Nrg1 T C 8: 32,321,273 (GRCm39) probably null Het
Or1o4 A T 17: 37,591,182 (GRCm39) L43* probably null Het
Or56a3b G A 7: 104,771,557 (GRCm39) V298I probably benign Het
Or56b35 A T 7: 104,963,579 (GRCm39) M123L probably benign Het
Pramel16 A T 4: 143,677,290 (GRCm39) D96E possibly damaging Het
Pramel23 G T 4: 143,424,590 (GRCm39) C284* probably null Het
Ptger2 T A 14: 45,226,439 (GRCm39) N6K possibly damaging Het
Ryr1 T A 7: 28,778,205 (GRCm39) E2097V probably damaging Het
Sel1l A T 12: 91,786,868 (GRCm39) F397Y probably damaging Het
Skint5 A G 4: 113,685,064 (GRCm39) V551A unknown Het
Slc39a12 A G 2: 14,405,142 (GRCm39) T245A probably benign Het
Syne1 C T 10: 5,308,438 (GRCm39) V706I probably benign Het
Tbc1d8 G T 1: 39,411,855 (GRCm39) Q994K possibly damaging Het
Tnrc6b C T 15: 80,760,854 (GRCm39) T187I probably benign Het
Ttll6 G A 11: 96,045,582 (GRCm39) A600T probably benign Het
Ust T C 10: 8,123,844 (GRCm39) probably benign Het
Vmn2r71 GT GTT 7: 85,268,426 (GRCm39) probably null Het
Vstm2a C T 11: 16,213,041 (GRCm39) A142V probably damaging Het
Wfs1 T A 5: 37,131,066 (GRCm39) probably benign Het
Wrap73 G A 4: 154,236,106 (GRCm39) G145D probably damaging Het
Wrap73 G A 4: 154,240,611 (GRCm39) V368M possibly damaging Het
Xrra1 T A 7: 99,524,352 (GRCm39) probably null Het
Zfhx2 C T 14: 55,301,547 (GRCm39) V2146I probably benign Het
Zfp335 A T 2: 164,749,842 (GRCm39) L185* probably null Het
Other mutations in Kbtbd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01583:Kbtbd4 APN 2 90,736,252 (GRCm39) missense probably damaging 1.00
R0306:Kbtbd4 UTSW 2 90,744,530 (GRCm39) unclassified probably benign
R0666:Kbtbd4 UTSW 2 90,744,459 (GRCm39) unclassified probably benign
R1935:Kbtbd4 UTSW 2 90,737,895 (GRCm39) missense probably damaging 0.99
R4207:Kbtbd4 UTSW 2 90,740,099 (GRCm39) missense probably damaging 0.99
R5658:Kbtbd4 UTSW 2 90,736,423 (GRCm39) missense probably benign 0.09
R5977:Kbtbd4 UTSW 2 90,736,487 (GRCm39) missense probably benign 0.39
R6546:Kbtbd4 UTSW 2 90,739,635 (GRCm39) missense probably damaging 1.00
R6653:Kbtbd4 UTSW 2 90,740,113 (GRCm39) nonsense probably null
R6714:Kbtbd4 UTSW 2 90,736,183 (GRCm39) unclassified probably benign
R7690:Kbtbd4 UTSW 2 90,736,240 (GRCm39) missense possibly damaging 0.69
R8090:Kbtbd4 UTSW 2 90,736,183 (GRCm39) unclassified probably benign
R9089:Kbtbd4 UTSW 2 90,737,909 (GRCm39) missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- GCATCTGATGATGGATACCAAGCATACA -3'
(R):5'- CCGACTCCCCAGTTCTTAGTAACTTCAA -3'

Sequencing Primer
(F):5'- catgtggtatacagatatatgcagac -3'
(R):5'- acacacacacacacacgg -3'
Posted On 2013-06-12