Incidental Mutation 'R0533:Ttll6'
ID 49334
Institutional Source Beutler Lab
Gene Symbol Ttll6
Ensembl Gene ENSMUSG00000038756
Gene Name tubulin tyrosine ligase-like family, member 6
Synonyms D11Moh43e, t8130b59, 4932418K24Rik, D11Moh44e
MMRRC Submission 038725-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0533 (G1)
Quality Score 215
Status Validated
Chromosome 11
Chromosomal Location 96133786-96165451 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 96154756 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 600 (A600T)
Ref Sequence ENSEMBL: ENSMUSP00000127778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107680] [ENSMUST00000167258]
AlphaFold A4Q9E8
Predicted Effect probably benign
Transcript: ENSMUST00000107680
AA Change: A496T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000103307
Gene: ENSMUSG00000038756
AA Change: A496T

DomainStartEndE-ValueType
Pfam:TTL 1 293 4.4e-90 PFAM
coiled coil region 376 402 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167258
AA Change: A600T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000127778
Gene: ENSMUSG00000038756
AA Change: A600T

DomainStartEndE-ValueType
low complexity region 7 29 N/A INTRINSIC
low complexity region 52 59 N/A INTRINSIC
Pfam:TTL 103 397 2.9e-90 PFAM
coiled coil region 480 506 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.5%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadat T G 8: 60,531,763 probably benign Het
Abcb1b A T 5: 8,864,113 probably null Het
Adcy10 A G 1: 165,564,023 N1283S probably benign Het
Adgrb1 T A 15: 74,541,559 W531R probably damaging Het
Ago4 A G 4: 126,516,860 V246A probably benign Het
Arid5b A T 10: 68,186,033 D242E probably damaging Het
Arpp21 A G 9: 112,126,505 V522A probably benign Het
Atg4b T A 1: 93,784,910 probably benign Het
Capn12 T C 7: 28,887,683 F359S possibly damaging Het
Ccdc88c A T 12: 100,954,282 I360N probably damaging Het
Clic3 A G 2: 25,458,138 Y99C probably damaging Het
Cux1 T C 5: 136,307,859 E925G probably damaging Het
Dnah10 G A 5: 124,775,250 probably null Het
Dnah17 A G 11: 118,110,537 V860A possibly damaging Het
Etv5 C T 16: 22,436,075 probably benign Het
Fam83a T A 15: 58,009,811 N345K probably benign Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gm13089 G T 4: 143,698,020 C284* probably null Het
Gpm6a A G 8: 55,055,374 probably null Het
Grid1 T A 14: 35,309,385 Y312N possibly damaging Het
Gstm4 T C 3: 108,043,525 N51S probably benign Het
Hid1 A T 11: 115,348,809 I765N probably damaging Het
Hmmr A G 11: 40,709,989 V518A unknown Het
Itgb6 A G 2: 60,669,197 V84A probably benign Het
Kbtbd4 A G 2: 90,907,604 K233E probably benign Het
Kif15 A T 9: 123,009,433 probably benign Het
Klre1 T C 6: 129,583,193 S143P probably damaging Het
Krt81 T C 15: 101,461,389 D216G probably benign Het
Mctp2 G T 7: 72,080,822 H868Q probably benign Het
Morc2b G C 17: 33,135,932 Y955* probably null Het
Myog A C 1: 134,290,473 N140H possibly damaging Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Neil3 A T 8: 53,638,775 probably null Het
Nrg1 T C 8: 31,831,245 probably null Het
Olfr681 G A 7: 105,122,350 V298I probably benign Het
Olfr689 A T 7: 105,314,372 M123L probably benign Het
Olfr99 A T 17: 37,280,291 L43* probably null Het
Pramef25 A T 4: 143,950,720 D96E possibly damaging Het
Ptger2 T A 14: 44,988,982 N6K possibly damaging Het
Ryr1 T A 7: 29,078,780 E2097V probably damaging Het
Sel1l A T 12: 91,820,094 F397Y probably damaging Het
Skint5 A G 4: 113,827,867 V551A unknown Het
Slc39a12 A G 2: 14,400,331 T245A probably benign Het
Syne1 C T 10: 5,358,438 V706I probably benign Het
Tbc1d8 G T 1: 39,372,774 Q994K possibly damaging Het
Tnrc6b C T 15: 80,876,653 T187I probably benign Het
Ust T C 10: 8,248,080 probably benign Het
Vmn2r71 GT GTT 7: 85,619,218 probably null Het
Vstm2a C T 11: 16,263,041 A142V probably damaging Het
Wfs1 T A 5: 36,973,722 probably benign Het
Wrap73 G A 4: 154,151,649 G145D probably damaging Het
Wrap73 G A 4: 154,156,154 V368M possibly damaging Het
Xrra1 T A 7: 99,875,145 probably null Het
Zfhx2 C T 14: 55,064,090 V2146I probably benign Het
Zfp335 A T 2: 164,907,922 L185* probably null Het
Other mutations in Ttll6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02152:Ttll6 APN 11 96135540 nonsense probably null
IGL02331:Ttll6 APN 11 96135747 missense probably damaging 1.00
IGL02490:Ttll6 APN 11 96156720 missense possibly damaging 0.55
IGL02551:Ttll6 APN 11 96154700 missense probably benign 0.00
IGL02618:Ttll6 APN 11 96147562 missense probably benign 0.04
IGL02712:Ttll6 APN 11 96139775 critical splice donor site probably benign
IGL02720:Ttll6 APN 11 96152073 critical splice donor site probably null
IGL02839:Ttll6 APN 11 96158820 missense probably damaging 1.00
IGL02974:Ttll6 APN 11 96156702 missense probably benign 0.06
IGL03038:Ttll6 APN 11 96151960 missense probably damaging 1.00
IGL03216:Ttll6 APN 11 96152014 missense probably benign 0.00
IGL03271:Ttll6 APN 11 96156687 missense probably benign 0.00
LCD18:Ttll6 UTSW 11 96155258 intron probably benign
R0295:Ttll6 UTSW 11 96154714 missense probably benign 0.09
R0310:Ttll6 UTSW 11 96147556 missense probably benign 0.41
R0466:Ttll6 UTSW 11 96145591 missense probably damaging 1.00
R1195:Ttll6 UTSW 11 96135729 missense probably damaging 1.00
R1195:Ttll6 UTSW 11 96135729 missense probably damaging 1.00
R1195:Ttll6 UTSW 11 96135729 missense probably damaging 1.00
R1453:Ttll6 UTSW 11 96158888 missense possibly damaging 0.82
R1555:Ttll6 UTSW 11 96145582 missense probably damaging 1.00
R1860:Ttll6 UTSW 11 96138874 nonsense probably null
R1861:Ttll6 UTSW 11 96138874 nonsense probably null
R1998:Ttll6 UTSW 11 96139775 critical splice donor site probably null
R2034:Ttll6 UTSW 11 96135526 missense probably damaging 0.99
R2126:Ttll6 UTSW 11 96147532 missense probably damaging 1.00
R3722:Ttll6 UTSW 11 96133921 missense probably benign 0.00
R4684:Ttll6 UTSW 11 96153177 missense probably benign
R4747:Ttll6 UTSW 11 96145546 missense possibly damaging 0.46
R4771:Ttll6 UTSW 11 96133829 missense possibly damaging 0.53
R4955:Ttll6 UTSW 11 96138789 missense possibly damaging 0.87
R5042:Ttll6 UTSW 11 96154604 missense possibly damaging 0.95
R5910:Ttll6 UTSW 11 96135589 missense possibly damaging 0.90
R5951:Ttll6 UTSW 11 96145510 missense probably damaging 1.00
R6033:Ttll6 UTSW 11 96134887 missense probably damaging 1.00
R6033:Ttll6 UTSW 11 96134887 missense probably damaging 1.00
R6134:Ttll6 UTSW 11 96139742 missense possibly damaging 0.69
R6263:Ttll6 UTSW 11 96156545 missense probably benign
R6325:Ttll6 UTSW 11 96135505 missense probably damaging 1.00
R6395:Ttll6 UTSW 11 96156588 missense probably benign 0.05
R6453:Ttll6 UTSW 11 96158727 missense probably benign 0.00
R6681:Ttll6 UTSW 11 96138863 missense probably damaging 1.00
R7481:Ttll6 UTSW 11 96154846 missense probably benign
R7574:Ttll6 UTSW 11 96134875 missense probably damaging 0.99
R8130:Ttll6 UTSW 11 96156599 missense probably benign 0.05
R8771:Ttll6 UTSW 11 96151936 missense probably damaging 1.00
R8887:Ttll6 UTSW 11 96156666 missense possibly damaging 0.69
R9452:Ttll6 UTSW 11 96135762 missense probably damaging 1.00
R9547:Ttll6 UTSW 11 96158762 missense probably benign 0.01
R9581:Ttll6 UTSW 11 96158746 missense probably benign 0.31
X0022:Ttll6 UTSW 11 96158741 missense probably damaging 0.99
Z1176:Ttll6 UTSW 11 96134897 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACCTTAGTATCCTGCACATCTGGC -3'
(R):5'- GATGGCTCAGCGGTTCTAATACCAC -3'

Sequencing Primer
(F):5'- GCTTGCTCTTGAACATCAGAGG -3'
(R):5'- AGCAGATATGCCGTTCCACTG -3'
Posted On 2013-06-12