Mutagenetix > Incidental Mutations

Incidental Mutation 'R5964:Dnah3'

471948

Institutional Source

Beutler Lab

Gene Symbol

Dnah3

Ensembl Gene

ENSMUSG00000052273

Gene Name

dynein, axonemal, heavy chain 3

Synonyms

MMRRC Submission

044149-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.100) question?

Stock #

R5964 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

119922671-120095280 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 119922880 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 4030 (D4030G)

Ref Sequence

ENSEMBL: ENSMUSP00000042857 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046993] [ENSMUST00000207270] [ENSMUST00000208424] [ENSMUST00000208701] [ENSMUST00000209154] [ENSMUST00000213149]

Predicted Effect

probably benign
Transcript: ENSMUST00000046993
AA Change: D4030G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000042857
Gene: ENSMUSG00000052273
AA Change: D4030G

Domain	Start	End	E-Value	Type
low complexity region	121	133	N/A	INTRINSIC
low complexity region	805	820	N/A	INTRINSIC
Pfam:DHC_N2	826	1235	3.3e-144	PFAM
AAA	1388	1527	1.59e-1	SMART
low complexity region	1594	1606	N/A	INTRINSIC
Blast:AAA	1669	1897	9e-84	BLAST
AAA	2033	2180	1.33e-3	SMART
Pfam:AAA_8	2362	2632	1.5e-63	PFAM
Pfam:MT	2644	2994	7.4e-52	PFAM
Pfam:AAA_9	3015	3240	3.5e-92	PFAM
low complexity region	3338	3349	N/A	INTRINSIC
Pfam:Dynein_heavy	3376	4079	4.4e-285	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000207270

Predicted Effect

probably benign
Transcript: ENSMUST00000208424

Predicted Effect

probably benign
Transcript: ENSMUST00000208701

Predicted Effect

probably benign
Transcript: ENSMUST00000209154
AA Change: D4019G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000213149

Meta Mutation Damage Score

0.1019

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.5%
20x: 92.2%

Validation Efficiency

96% (87/91)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the dynein family, whose members encode large proteins that are constituents of the microtubule-associated motor protein complex. This complex is composed of dynein heavy, intermediate and light chains, which can be axonemal or cytoplasmic. This protein is an axonemal dynein heavy chain. It is involved in producing force for ciliary beating by using energy from ATP hydrolysis. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Dec 2016]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam15	G	A	3: 89,343,567	Q581*	probably null	Het
Agl	A	G	3: 116,793,774	V44A	probably damaging	Het
Alpk3	T	A	7: 81,092,260	D608E	possibly damaging	Het
Aspm	C	A	1: 139,455,227		probably benign	Het
Bbs2	T	C	8: 94,068,367	N692S	probably benign	Het
Bend4	A	G	5: 67,417,818	I240T	probably benign	Het
Casp8	G	T	1: 58,833,736	R277L	possibly damaging	Het
Ccdc61	A	T	7: 18,900,940	I123N	probably damaging	Het
Ccr9	T	G	9: 123,779,434	I60M	probably benign	Het
Cd163	T	A	6: 124,326,572	W1066R	probably benign	Het
Cd226	A	T	18: 89,207,183	H68L	probably benign	Het
Cdkn3	T	A	14: 46,767,217	C79S	probably null	Het
Cnnm1	A	T	19: 43,469,723	E658V	probably benign	Het
Cog7	T	C	7: 121,956,029	R304G	probably damaging	Het
Cpt1a	T	A	19: 3,365,760	V286E	possibly damaging	Het
Creg2	C	A	1: 39,624,954	R212L	probably benign	Het
Cyp26a1	T	G	19: 37,699,962	S311A	probably damaging	Het
Cyp2b10	T	C	7: 25,926,223	Y484H	probably benign	Het
Cyp3a44	T	A	5: 145,788,467	Y308F	possibly damaging	Het
Dlg5	A	G	14: 24,164,089	V744A	probably benign	Het
Dlgap2	T	A	8: 14,727,128	Y124*	probably null	Het
Dnah5	A	G	15: 28,458,584	T4456A	possibly damaging	Het
Dtx2	T	A	5: 136,023,699	V347D	probably benign	Het
Gigyf2	C	T	1: 87,407,167	T294M	probably damaging	Het
Gli3	C	G	13: 15,726,162	S1378*	probably null	Het
Gm884	A	G	11: 103,542,120	S1232P	possibly damaging	Het
Gnao1	G	A	8: 93,966,999	D337N	probably benign	Het
Gp2	T	A	7: 119,449,129	Q422L	probably benign	Het
Ifit1	T	A	19: 34,648,469	M335K	possibly damaging	Het
Ism1	T	C	2: 139,678,757	S30P	probably benign	Het
Itgax	A	G	7: 128,140,447	D677G	probably damaging	Het
Kansl1l	G	A	1: 66,725,922	A442V	probably damaging	Het
Kif13a	T	C	13: 46,771,524	I311M	probably damaging	Het
Lsm14b	T	A	2: 180,031,425	S84R	probably benign	Het
Lzts3	A	G	2: 130,636,288	Y297H	probably damaging	Het
Map4k3	A	G	17: 80,644,762	I205T	probably damaging	Het
Matn2	A	T	15: 34,410,165	N501I	probably damaging	Het
Mctp2	T	C	7: 72,103,177	E776G	probably damaging	Het
Mex3d	A	T	10: 80,382,587	N265K	probably damaging	Het
Myo5a	A	G	9: 75,203,833	T1534A	probably benign	Het
Ncoa7	T	C	10: 30,704,636	M35V	probably damaging	Het
Nek4	G	A	14: 30,957,079		probably null	Het
Ngrn	T	C	7: 80,261,933		probably null	Het
Nlrp1a	T	A	11: 71,123,020	Q468L	probably benign	Het
Olfr1450	A	C	19: 12,954,531	Q314P	probably benign	Het
Olfr743	T	A	14: 50,534,198	M262K	probably damaging	Het
Phtf2	T	C	5: 20,775,934	D433G	probably damaging	Het
Prdm13	G	A	4: 21,683,852	Q140*	probably null	Het
Prtg	G	A	9: 72,892,254	G778E	probably benign	Het
Pum3	T	C	19: 27,420,051	E308G	probably damaging	Het
Pwp1	T	G	10: 85,882,886	F306V	probably damaging	Het
Rab24	A	T	13: 55,321,576	Y27N	probably damaging	Het
Rnf215	T	C	11: 4,135,898	F126L	probably benign	Het
Samd13	A	T	3: 146,680,696		probably benign	Het
Serac1	T	A	17: 6,065,049	H213L	probably benign	Het
Slc45a3	A	G	1: 131,978,073	E278G	probably damaging	Het
Slit3	C	T	11: 35,700,236	R1292C	probably damaging	Het
Slx4	A	T	16: 4,000,951		probably null	Het
Smarca4	C	A	9: 21,647,430	T631K	probably benign	Het
Snx16	C	T	3: 10,434,481	R163Q	possibly damaging	Het
Stk40	T	C	4: 126,128,895	V140A	probably damaging	Het
Tcf12	A	T	9: 71,868,240	D409E	probably damaging	Het
Tgfbr2	G	T	9: 116,110,255	T168K	possibly damaging	Het
Ticam1	G	T	17: 56,271,703	H131N	probably damaging	Het
Ttn	C	A	2: 76,713,511	E31298*	probably null	Het
Ttn	C	A	2: 76,829,888	R7458I	possibly damaging	Het
Usp7	A	G	16: 8,712,102	V133A	possibly damaging	Het
Wbp1l	C	T	19: 46,654,180	R191*	probably null	Het
Wdfy4	T	C	14: 33,106,011	E1118G	probably damaging	Het
Zfp81	G	C	17: 33,336,845	P3A	probably damaging	Het
Znhit6	A	G	3: 145,576,933	K21R	possibly damaging	Het

Other mutations in Dnah3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00650:Dnah3	APN	7	119938905	missense	possibly damaging	0.88
IGL01095:Dnah3	APN	7	119951597	missense	probably benign	0.02
IGL01329:Dnah3	APN	7	120022941	missense	probably damaging	1.00
IGL01380:Dnah3	APN	7	119926564	missense	probably damaging	1.00
IGL01410:Dnah3	APN	7	119967720	missense	possibly damaging	0.91
IGL01487:Dnah3	APN	7	119965530	nonsense	probably null
IGL01843:Dnah3	APN	7	119943575	missense	probably benign	0.12
IGL01929:Dnah3	APN	7	119951651	nonsense	probably null
IGL01994:Dnah3	APN	7	119951214	missense	possibly damaging	0.58
IGL02115:Dnah3	APN	7	120029054	missense	probably damaging	1.00
IGL02273:Dnah3	APN	7	119951271	missense	probably damaging	1.00
IGL02299:Dnah3	APN	7	119967579	missense	probably benign	0.39
IGL02421:Dnah3	APN	7	119950992	missense	possibly damaging	0.87
IGL02514:Dnah3	APN	7	119966247	missense	probably damaging	1.00
IGL02596:Dnah3	APN	7	119938914	missense	probably benign	0.19
IGL02716:Dnah3	APN	7	119937023	missense	probably damaging	0.97
IGL02738:Dnah3	APN	7	119965497	missense	probably benign
IGL03404:Dnah3	APN	7	119938977	missense	probably damaging	1.00
BB004:Dnah3	UTSW	7	119951271	missense	probably damaging	0.97
BB014:Dnah3	UTSW	7	119951271	missense	probably damaging	0.97
R0011:Dnah3	UTSW	7	120019701	missense	probably damaging	1.00
R0195:Dnah3	UTSW	7	120077775	critical splice donor site	probably null
R0241:Dnah3	UTSW	7	119922730	missense	probably damaging	1.00
R0241:Dnah3	UTSW	7	119922730	missense	probably damaging	1.00
R0312:Dnah3	UTSW	7	120045659	missense	probably damaging	1.00
R0316:Dnah3	UTSW	7	119965659	missense	possibly damaging	0.94
R0370:Dnah3	UTSW	7	120086720	missense	possibly damaging	0.91
R0426:Dnah3	UTSW	7	119943572	missense	probably benign	0.11
R0525:Dnah3	UTSW	7	119928754	missense	probably damaging	1.00
R0625:Dnah3	UTSW	7	120071887	missense	possibly damaging	0.68
R0627:Dnah3	UTSW	7	120020915	missense	probably damaging	1.00
R0632:Dnah3	UTSW	7	119967905	missense	probably benign	0.11
R0928:Dnah3	UTSW	7	120030051	missense	probably damaging	1.00
R0964:Dnah3	UTSW	7	119952739	splice site	probably benign
R0972:Dnah3	UTSW	7	120035340	splice site	probably null
R1066:Dnah3	UTSW	7	120061009	missense	probably damaging	1.00
R1082:Dnah3	UTSW	7	120078445	missense	probably damaging	1.00
R1127:Dnah3	UTSW	7	119923030	missense	probably damaging	1.00
R1132:Dnah3	UTSW	7	119939004	missense	possibly damaging	0.50
R1222:Dnah3	UTSW	7	120090676	missense	probably benign	0.28
R1420:Dnah3	UTSW	7	119951979	missense	probably damaging	0.99
R1456:Dnah3	UTSW	7	120047630	missense	probably damaging	1.00
R1472:Dnah3	UTSW	7	120070958	missense	probably benign	0.12
R1617:Dnah3	UTSW	7	120089946	missense	probably benign	0.01
R1624:Dnah3	UTSW	7	120019695	missense	probably damaging	0.99
R1654:Dnah3	UTSW	7	119926449	missense	probably damaging	1.00
R1673:Dnah3	UTSW	7	119971179	nonsense	probably null
R1677:Dnah3	UTSW	7	119928740	missense	probably damaging	1.00
R1687:Dnah3	UTSW	7	120045786	splice site	probably null
R1711:Dnah3	UTSW	7	120078571	missense	probably damaging	1.00
R1738:Dnah3	UTSW	7	120035359	missense	probably damaging	1.00
R1778:Dnah3	UTSW	7	120078402	missense	probably damaging	1.00
R1866:Dnah3	UTSW	7	119928856	splice site	probably null
R1883:Dnah3	UTSW	7	120077919	missense	probably benign	0.06
R1894:Dnah3	UTSW	7	120086334	missense	probably benign	0.05
R1929:Dnah3	UTSW	7	119975129	missense	probably benign	0.10
R1988:Dnah3	UTSW	7	119967570	missense	possibly damaging	0.92
R1988:Dnah3	UTSW	7	119967959	missense	probably damaging	0.99
R2010:Dnah3	UTSW	7	120095177	start codon destroyed	probably benign	0.00
R2022:Dnah3	UTSW	7	119951242	missense	probably damaging	1.00
R2026:Dnah3	UTSW	7	120039406	missense	probably damaging	1.00
R2063:Dnah3	UTSW	7	119951909	missense	probably damaging	0.96
R2131:Dnah3	UTSW	7	119967759	missense	possibly damaging	0.93
R2152:Dnah3	UTSW	7	119952013	missense	probably benign	0.02
R2199:Dnah3	UTSW	7	119951569	missense	possibly damaging	0.89
R2271:Dnah3	UTSW	7	119975129	missense	probably benign	0.10
R2350:Dnah3	UTSW	7	120045788	splice site	probably null
R2567:Dnah3	UTSW	7	119952697	missense	possibly damaging	0.83
R2848:Dnah3	UTSW	7	119967938	missense	probably benign	0.01
R2902:Dnah3	UTSW	7	119951499	missense	possibly damaging	0.61
R2926:Dnah3	UTSW	7	119951115	missense	probably damaging	1.00
R2944:Dnah3	UTSW	7	119951110	missense	probably damaging	1.00
R3022:Dnah3	UTSW	7	120078481	missense	possibly damaging	0.93
R3401:Dnah3	UTSW	7	119967656	missense	probably benign	0.00
R3402:Dnah3	UTSW	7	119967656	missense	probably benign	0.00
R3403:Dnah3	UTSW	7	119967656	missense	probably benign	0.00
R3919:Dnah3	UTSW	7	119951080	missense	probably damaging	1.00
R3972:Dnah3	UTSW	7	120086720	missense	probably damaging	0.99
R4162:Dnah3	UTSW	7	119922838	missense	probably damaging	1.00
R4184:Dnah3	UTSW	7	120083293	missense	probably damaging	1.00
R4198:Dnah3	UTSW	7	119922838	missense	probably damaging	1.00
R4199:Dnah3	UTSW	7	119922838	missense	probably damaging	1.00
R4200:Dnah3	UTSW	7	119922838	missense	probably damaging	1.00
R4239:Dnah3	UTSW	7	120029025	nonsense	probably null
R4478:Dnah3	UTSW	7	120071863	missense	probably benign	0.00
R4579:Dnah3	UTSW	7	120009331	missense	probably damaging	1.00
R4600:Dnah3	UTSW	7	120089946	missense	probably benign
R4649:Dnah3	UTSW	7	120047698	missense	probably damaging	1.00
R4658:Dnah3	UTSW	7	119950651	missense	probably damaging	1.00
R4728:Dnah3	UTSW	7	120059366	missense	probably damaging	0.99
R4739:Dnah3	UTSW	7	120077946	missense	possibly damaging	0.54
R4758:Dnah3	UTSW	7	120079406	missense	probably benign	0.00
R4785:Dnah3	UTSW	7	119967824	missense	probably benign	0.29
R4789:Dnah3	UTSW	7	120011072	missense	probably damaging	1.00
R4930:Dnah3	UTSW	7	119951681	nonsense	probably null
R4935:Dnah3	UTSW	7	120016477	nonsense	probably null
R4946:Dnah3	UTSW	7	119931560	missense	probably damaging	1.00
R4981:Dnah3	UTSW	7	119956201	missense	probably benign	0.03
R4984:Dnah3	UTSW	7	119928779	missense	probably benign	0.04
R5025:Dnah3	UTSW	7	120071905	missense	probably benign	0.02
R5046:Dnah3	UTSW	7	119951580	missense	probably damaging	1.00
R5056:Dnah3	UTSW	7	120020946	missense	probably damaging	1.00
R5068:Dnah3	UTSW	7	120032790	missense	probably benign
R5069:Dnah3	UTSW	7	120032790	missense	probably benign
R5154:Dnah3	UTSW	7	119952419	missense	probably damaging	1.00
R5208:Dnah3	UTSW	7	120032638	missense	probably damaging	1.00
R5323:Dnah3	UTSW	7	120021011	missense	probably damaging	1.00
R5330:Dnah3	UTSW	7	119943648	missense	probably benign	0.00
R5385:Dnah3	UTSW	7	119924903	missense	probably damaging	1.00
R5391:Dnah3	UTSW	7	120090076	missense	probably benign	0.02
R5564:Dnah3	UTSW	7	119971466	critical splice donor site	probably null
R5594:Dnah3	UTSW	7	119971621	missense	possibly damaging	0.89
R5610:Dnah3	UTSW	7	119939065	splice site	probably null
R5673:Dnah3	UTSW	7	119951589	missense	possibly damaging	0.91
R5678:Dnah3	UTSW	7	120077851	missense	probably benign	0.00
R5737:Dnah3	UTSW	7	120059198	missense	probably benign	0.03
R5766:Dnah3	UTSW	7	119978222	missense	probably damaging	1.00
R5769:Dnah3	UTSW	7	120089952	nonsense	probably null
R5789:Dnah3	UTSW	7	119943599	missense	possibly damaging	0.70
R5791:Dnah3	UTSW	7	119931473	missense	probably benign	0.00
R5841:Dnah3	UTSW	7	119951021	utr 3 prime	probably benign
R5843:Dnah3	UTSW	7	119951021	utr 3 prime	probably benign
R5844:Dnah3	UTSW	7	119951021	utr 3 prime	probably benign
R5846:Dnah3	UTSW	7	119951021	utr 3 prime	probably benign
R5851:Dnah3	UTSW	7	120039362	missense	possibly damaging	0.51
R5853:Dnah3	UTSW	7	119938833	missense	probably damaging	1.00
R5857:Dnah3	UTSW	7	119951021	utr 3 prime	probably benign
R5865:Dnah3	UTSW	7	119975108	missense	probably benign	0.00
R5885:Dnah3	UTSW	7	120069704	missense	probably benign	0.10
R5898:Dnah3	UTSW	7	120078501	missense	probably benign	0.37
R5917:Dnah3	UTSW	7	120016526	missense	probably damaging	1.00
R5990:Dnah3	UTSW	7	120073541	missense	probably benign
R6004:Dnah3	UTSW	7	120086297	missense	probably benign	0.10
R6033:Dnah3	UTSW	7	120071647	missense	probably benign	0.00
R6033:Dnah3	UTSW	7	120071647	missense	probably benign	0.00
R6045:Dnah3	UTSW	7	119967522	missense	probably damaging	0.99
R6056:Dnah3	UTSW	7	120030031	missense	probably damaging	1.00
R6133:Dnah3	UTSW	7	120086246	missense	probably benign	0.10
R6229:Dnah3	UTSW	7	119965488	missense	probably benign	0.11
R6237:Dnah3	UTSW	7	120009384	missense	probably damaging	1.00
R6333:Dnah3	UTSW	7	120054633	missense	probably damaging	1.00
R6408:Dnah3	UTSW	7	119922968	splice site	probably null
R6447:Dnah3	UTSW	7	119923054	missense	probably benign	0.12
R6606:Dnah3	UTSW	7	120060956	missense	probably benign	0.02
R6666:Dnah3	UTSW	7	120070949	missense	probably benign	0.16
R6733:Dnah3	UTSW	7	119922974	missense	probably benign	0.22
R6815:Dnah3	UTSW	7	119971727	missense	probably benign
R6882:Dnah3	UTSW	7	119971184	missense	possibly damaging	0.95
R6934:Dnah3	UTSW	7	120054601	critical splice donor site	probably null
R6966:Dnah3	UTSW	7	120032754	missense	probably damaging	1.00
R7025:Dnah3	UTSW	7	120030010	missense	possibly damaging	0.90
R7207:Dnah3	UTSW	7	119971089	missense	probably damaging	1.00
R7214:Dnah3	UTSW	7	119922742	missense	probably damaging	1.00
R7222:Dnah3	UTSW	7	120071523	missense	probably benign	0.00
R7235:Dnah3	UTSW	7	120032670	missense	probably damaging	1.00
R7241:Dnah3	UTSW	7	119943633	missense	probably benign	0.03
R7313:Dnah3	UTSW	7	119981344	missense	probably benign	0.39
R7342:Dnah3	UTSW	7	120029985	missense	probably damaging	1.00
R7368:Dnah3	UTSW	7	120029016	missense	probably benign
R7375:Dnah3	UTSW	7	119951677	missense	probably damaging	1.00
R7395:Dnah3	UTSW	7	119966251	missense
R7395:Dnah3	UTSW	7	120060960	missense	probably benign	0.00
R7431:Dnah3	UTSW	7	120051744	missense	probably damaging	1.00
R7499:Dnah3	UTSW	7	120060912	missense	probably damaging	0.99
R7515:Dnah3	UTSW	7	120073592	missense	probably benign	0.21
R7564:Dnah3	UTSW	7	119971594	missense	probably benign
R7618:Dnah3	UTSW	7	119978378	missense	probably damaging	0.97
R7697:Dnah3	UTSW	7	119967434	missense
R7728:Dnah3	UTSW	7	119938828	missense	probably damaging	1.00
R7757:Dnah3	UTSW	7	120071570	missense	probably benign
R7757:Dnah3	UTSW	7	119971215	splice site	probably null
R7774:Dnah3	UTSW	7	119951752	nonsense	probably null
R7804:Dnah3	UTSW	7	119952618	missense	probably damaging	1.00
R7804:Dnah3	UTSW	7	120011012	missense	probably damaging	1.00
R7857:Dnah3	UTSW	7	119951704	missense	probably damaging	1.00
R7871:Dnah3	UTSW	7	119967552	missense
R7903:Dnah3	UTSW	7	120042128	missense	probably damaging	1.00
R7927:Dnah3	UTSW	7	119951271	missense	probably damaging	0.97
R7989:Dnah3	UTSW	7	120077789	missense	probably benign
R8142:Dnah3	UTSW	7	120060966	missense	probably benign	0.00
R8164:Dnah3	UTSW	7	119967614	missense	probably damaging	1.00
R8237:Dnah3	UTSW	7	119926413	missense	probably benign	0.01
R8313:Dnah3	UTSW	7	119951152	missense	probably benign	0.38
R8338:Dnah3	UTSW	7	120071881	missense	probably benign	0.01
R8355:Dnah3	UTSW	7	119952208	missense	probably damaging	1.00
R8408:Dnah3	UTSW	7	119952505	missense	probably damaging	1.00
R8411:Dnah3	UTSW	7	120011030	missense	probably damaging	1.00
R8455:Dnah3	UTSW	7	119952208	missense	probably damaging	1.00
Z1088:Dnah3	UTSW	7	120010873	missense	probably null	1.00
Z1088:Dnah3	UTSW	7	120086297	missense	probably benign	0.00
Z1176:Dnah3	UTSW	7	119967803	missense
Z1177:Dnah3	UTSW	7	119967901	missense	probably damaging	0.99
Z1177:Dnah3	UTSW	7	120007862	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGCCATCAATTATCCAGCTGG -3'
(R):5'- ACTTGGCAGCTAGGTGGTTC -3'

Sequencing Primer
(F):5'- TGGCACAGTGAGGCCAC -3'
(R):5'- GATTATGACACTCATAGCTTTCCAC -3'

Posted On

2017-03-31