Incidental Mutation 'R6465:Olfr711'
ID517775
Institutional Source Beutler Lab
Gene Symbol Olfr711
Ensembl Gene ENSMUSG00000045013
Gene Nameolfactory receptor 711
SynonymsGA_x6K02T2PBJ9-9352783-9351839, MOR103-4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R6465 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location106969694-106975453 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 106972212 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 44 (V44E)
Ref Sequence ENSEMBL: ENSMUSP00000149016 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051715] [ENSMUST00000207200] [ENSMUST00000216335]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051715
AA Change: V44E

PolyPhen 2 Score 0.630 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000055724
Gene: ENSMUSG00000045013
AA Change: V44E

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.5e-58 PFAM
Pfam:7tm_1 41 290 1.2e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000207200
AA Change: V44E

PolyPhen 2 Score 0.630 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216335
AA Change: V44E

PolyPhen 2 Score 0.630 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230113P08Rik A T 9: 35,908,625 N25Y possibly damaging Het
A2ml1 G A 6: 128,541,078 T1415I probably damaging Het
Acvr2b T A 9: 119,433,303 W461R probably damaging Het
Adam23 G T 1: 63,566,668 C637F probably damaging Het
Apol8 T G 15: 77,749,948 T143P probably benign Het
Asna1 A T 8: 85,018,565 M291K probably benign Het
Bfsp1 A C 2: 143,858,055 probably null Het
Cytl1 T C 5: 37,737,670 V99A probably benign Het
Dock2 A T 11: 34,503,413 V793E probably damaging Het
Fxyd5 G T 7: 31,037,880 T81K probably damaging Het
Gcm1 A G 9: 78,064,869 Y364C probably damaging Het
Gm37596 A G 3: 93,692,996 I22T probably damaging Het
Gm9992 G T 17: 7,374,443 T202K probably damaging Het
Haghl T C 17: 25,783,819 N190S possibly damaging Het
Inpp5j C A 11: 3,502,293 R319L possibly damaging Het
Ints10 A G 8: 68,807,536 N304S probably benign Het
Isoc1 T A 18: 58,671,256 C119S probably damaging Het
Klhl18 A G 9: 110,428,920 M414T probably benign Het
Krtap2-4 A G 11: 99,614,759 probably benign Het
Krtap3-1 G A 11: 99,566,451 P45S possibly damaging Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Myo7a A G 7: 98,062,680 V1754A possibly damaging Het
Nedd4l T A 18: 65,155,264 D119E probably benign Het
Nsun7 T C 5: 66,295,586 V548A probably benign Het
Olfr1024 A T 2: 85,904,539 S172T probably benign Het
Parvg A G 15: 84,328,940 D127G probably damaging Het
Piezo2 T A 18: 63,041,663 M2007L possibly damaging Het
Pou2f3 A C 9: 43,139,867 F175V probably damaging Het
Ptprn2 T C 12: 117,269,589 I958T probably damaging Het
Pwwp2b T C 7: 139,256,035 V464A probably benign Het
Pzp A G 6: 128,491,619 Y982H probably damaging Het
Rad17 T A 13: 100,637,080 N202I probably benign Het
Rtel1 T A 2: 181,335,940 D271E possibly damaging Het
Sos2 T C 12: 69,596,775 S943G probably benign Het
Tm9sf2 A G 14: 122,141,207 H241R probably benign Het
Ttc8 A G 12: 98,964,570 E291G probably damaging Het
Wfikkn1 A G 17: 25,878,718 C211R probably damaging Het
Ylpm1 T A 12: 85,049,802 D1219E probably damaging Het
Zc3hav1 T C 6: 38,331,849 Y586C possibly damaging Het
Zcchc4 T A 5: 52,819,276 F471I probably benign Het
Zfp719 C A 7: 43,590,684 Y565* probably null Het
Other mutations in Olfr711
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02600:Olfr711 APN 7 106971549 missense possibly damaging 0.51
R0087:Olfr711 UTSW 7 106972116 missense probably benign 0.01
R0580:Olfr711 UTSW 7 106972240 missense probably damaging 1.00
R1375:Olfr711 UTSW 7 106972098 missense probably damaging 1.00
R1538:Olfr711 UTSW 7 106971983 nonsense probably null
R1875:Olfr711 UTSW 7 106972182 missense possibly damaging 0.86
R2156:Olfr711 UTSW 7 106971568 missense probably damaging 1.00
R4290:Olfr711 UTSW 7 106971711 missense probably damaging 0.97
R4332:Olfr711 UTSW 7 106972147 missense probably benign 0.00
R4400:Olfr711 UTSW 7 106972002 missense probably damaging 1.00
R4688:Olfr711 UTSW 7 106971861 missense probably benign 0.02
R4868:Olfr711 UTSW 7 106971767 missense probably benign
R4970:Olfr711 UTSW 7 106971571 missense probably benign 0.35
R5006:Olfr711 UTSW 7 106971601 missense probably damaging 1.00
R5082:Olfr711 UTSW 7 106971664 missense probably benign 0.00
R5121:Olfr711 UTSW 7 106972231 missense probably benign
R6541:Olfr711 UTSW 7 106972203 missense probably benign 0.20
R7419:Olfr711 UTSW 7 106972146 missense probably benign 0.01
R8048:Olfr711 UTSW 7 106972464 start gained probably benign
Z1177:Olfr711 UTSW 7 106971915 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTCTGTGCAGGCAAGTGAG -3'
(R):5'- CTGATGCCATAGACATTGCCC -3'

Sequencing Primer
(F):5'- CTCTGTGCAGGCAAGTGAGATAAAG -3'
(R):5'- GATGCCATAGACATTGCCCTTATTTG -3'
Posted On2018-05-21