Mutagenetix > Incidental Mutations

Incidental Mutation 'R6465:Pzp'

517771

Institutional Source

Beutler Lab

Gene Symbol

Pzp

Ensembl Gene

ENSMUSG00000030359

Gene Name

PZP, alpha-2-macroglobulin like

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.095) question?

Stock #

R6465 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

128483567-128526720 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 128491619 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 982 (Y982H)

Ref Sequence

ENSEMBL: ENSMUSP00000107760 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000112132]

Predicted Effect

probably damaging
Transcript: ENSMUST00000112132
AA Change: Y982H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000107760
Gene: ENSMUSG00000030359
AA Change: Y982H

Domain	Start	End	E-Value	Type
low complexity region	11	18	N/A	INTRINSIC
Pfam:A2M_N	126	219	3.2e-23	PFAM
low complexity region	327	338	N/A	INTRINSIC
A2M_N_2	458	606	6.18e-40	SMART
A2M	750	840	2.27e-38	SMART
Pfam:Thiol-ester_cl	973	1003	4e-19	PFAM
Pfam:A2M_comp	1022	1284	2.1e-90	PFAM
A2M_recep	1395	1482	6.47e-43	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203753

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000204037

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000204081

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000204291

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.8%
20x: 93.1%

Validation Efficiency

95% (40/42)

MGI Phenotype

PHENOTYPE: Homozygotes mutant null mice show higher bone mineral density, hypoactivity, and decreased heart rate. Mice homozygous for a different null allele show resistance to the lethal effects of endotoxin, increased susceptibility to diet-induced acute pancreatitis, and altered LPS-induced febrile and cytokine responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9230113P08Rik	A	T	9: 35,908,625	N25Y	possibly damaging	Het
A2ml1	G	A	6: 128,541,078	T1415I	probably damaging	Het
Acvr2b	T	A	9: 119,433,303	W461R	probably damaging	Het
Adam23	G	T	1: 63,566,668	C637F	probably damaging	Het
Apol8	T	G	15: 77,749,948	T143P	probably benign	Het
Asna1	A	T	8: 85,018,565	M291K	probably benign	Het
Bfsp1	A	C	2: 143,858,055		probably null	Het
Cytl1	T	C	5: 37,737,670	V99A	probably benign	Het
Dock2	A	T	11: 34,503,413	V793E	probably damaging	Het
Fxyd5	G	T	7: 31,037,880	T81K	probably damaging	Het
Gcm1	A	G	9: 78,064,869	Y364C	probably damaging	Het
Gm37596	A	G	3: 93,692,996	I22T	probably damaging	Het
Gm9992	G	T	17: 7,374,443	T202K	probably damaging	Het
Haghl	T	C	17: 25,783,819	N190S	possibly damaging	Het
Inpp5j	C	A	11: 3,502,293	R319L	possibly damaging	Het
Ints10	A	G	8: 68,807,536	N304S	probably benign	Het
Isoc1	T	A	18: 58,671,256	C119S	probably damaging	Het
Klhl18	A	G	9: 110,428,920	M414T	probably benign	Het
Krtap2-4	A	G	11: 99,614,759		probably benign	Het
Krtap3-1	G	A	11: 99,566,451	P45S	possibly damaging	Het
Mroh2a	GCCC	GC	1: 88,232,257		probably null	Het
Myo7a	A	G	7: 98,062,680	V1754A	possibly damaging	Het
Nedd4l	T	A	18: 65,155,264	D119E	probably benign	Het
Nsun7	T	C	5: 66,295,586	V548A	probably benign	Het
Olfr1024	A	T	2: 85,904,539	S172T	probably benign	Het
Olfr711	A	T	7: 106,972,212	V44E	possibly damaging	Het
Parvg	A	G	15: 84,328,940	D127G	probably damaging	Het
Piezo2	T	A	18: 63,041,663	M2007L	possibly damaging	Het
Pou2f3	A	C	9: 43,139,867	F175V	probably damaging	Het
Ptprn2	T	C	12: 117,269,589	I958T	probably damaging	Het
Pwwp2b	T	C	7: 139,256,035	V464A	probably benign	Het
Rad17	T	A	13: 100,637,080	N202I	probably benign	Het
Rtel1	T	A	2: 181,335,940	D271E	possibly damaging	Het
Sos2	T	C	12: 69,596,775	S943G	probably benign	Het
Tm9sf2	A	G	14: 122,141,207	H241R	probably benign	Het
Ttc8	A	G	12: 98,964,570	E291G	probably damaging	Het
Wfikkn1	A	G	17: 25,878,718	C211R	probably damaging	Het
Ylpm1	T	A	12: 85,049,802	D1219E	probably damaging	Het
Zc3hav1	T	C	6: 38,331,849	Y586C	possibly damaging	Het
Zcchc4	T	A	5: 52,819,276	F471I	probably benign	Het
Zfp719	C	A	7: 43,590,684	Y565*	probably null	Het

Other mutations in Pzp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00337:Pzp	APN	6	128516909	missense	probably benign	0.25
IGL01470:Pzp	APN	6	128521124	missense	probably benign	0.05
IGL01753:Pzp	APN	6	128502183	missense	possibly damaging	0.78
IGL01878:Pzp	APN	6	128495298	missense	probably damaging	1.00
IGL02307:Pzp	APN	6	128489086	nonsense	probably null
IGL02338:Pzp	APN	6	128486170	missense	probably benign	0.07
IGL02546:Pzp	APN	6	128494699	splice site	probably benign
IGL02598:Pzp	APN	6	128487457	missense	probably benign	0.00
IGL02699:Pzp	APN	6	128487401	critical splice donor site	probably null
P4748:Pzp	UTSW	6	128490089	missense	probably damaging	1.00
PIT4151001:Pzp	UTSW	6	128525296	missense	probably benign	0.34
PIT4495001:Pzp	UTSW	6	128502229	missense	probably benign
R0157:Pzp	UTSW	6	128523976	nonsense	probably null
R0195:Pzp	UTSW	6	128487478	missense	probably damaging	1.00
R0238:Pzp	UTSW	6	128489156	splice site	probably benign
R0239:Pzp	UTSW	6	128489156	splice site	probably benign
R0271:Pzp	UTSW	6	128519514	missense	probably damaging	1.00
R0299:Pzp	UTSW	6	128495330	splice site	probably benign
R0744:Pzp	UTSW	6	128516195	unclassified	probably benign
R0968:Pzp	UTSW	6	128525145	missense	probably benign	0.00
R1037:Pzp	UTSW	6	128519426	missense	probably benign	0.01
R1074:Pzp	UTSW	6	128487924	missense	probably benign	0.20
R1469:Pzp	UTSW	6	128512356	missense	probably benign	0.04
R1469:Pzp	UTSW	6	128512356	missense	probably benign	0.04
R1579:Pzp	UTSW	6	128523968	critical splice donor site	probably null
R1646:Pzp	UTSW	6	128503555	missense	probably benign	0.33
R1770:Pzp	UTSW	6	128485617	missense	probably damaging	1.00
R1777:Pzp	UTSW	6	128490572	missense	possibly damaging	0.85
R1786:Pzp	UTSW	6	128491161	splice site	probably null
R1854:Pzp	UTSW	6	128502225	missense	probably damaging	1.00
R2001:Pzp	UTSW	6	128516120	missense	probably benign	0.01
R2060:Pzp	UTSW	6	128483710	missense	probably benign	0.45
R2081:Pzp	UTSW	6	128519420	missense	probably benign	0.00
R2130:Pzp	UTSW	6	128491161	splice site	probably null
R2131:Pzp	UTSW	6	128491161	splice site	probably null
R2160:Pzp	UTSW	6	128525276	missense	probably damaging	1.00
R2168:Pzp	UTSW	6	128488047	missense	probably damaging	0.98
R2328:Pzp	UTSW	6	128510390	missense	possibly damaging	0.79
R2441:Pzp	UTSW	6	128489768	nonsense	probably null
R2866:Pzp	UTSW	6	128525264	missense	possibly damaging	0.76
R2869:Pzp	UTSW	6	128485556	critical splice donor site	probably null
R2869:Pzp	UTSW	6	128485556	critical splice donor site	probably null
R2870:Pzp	UTSW	6	128485556	critical splice donor site	probably null
R2870:Pzp	UTSW	6	128485556	critical splice donor site	probably null
R2873:Pzp	UTSW	6	128485556	critical splice donor site	probably null
R2876:Pzp	UTSW	6	128491550	missense	probably damaging	1.00
R3404:Pzp	UTSW	6	128513806	missense	probably damaging	1.00
R4452:Pzp	UTSW	6	128491240	missense	probably damaging	1.00
R4461:Pzp	UTSW	6	128524040	missense	probably benign	0.02
R5103:Pzp	UTSW	6	128502229	missense	probably benign	0.04
R5193:Pzp	UTSW	6	128502334	missense	probably benign	0.00
R5425:Pzp	UTSW	6	128489048	missense	probably damaging	0.97
R5465:Pzp	UTSW	6	128486961	missense	probably damaging	1.00
R5590:Pzp	UTSW	6	128523796	missense	probably damaging	1.00
R5656:Pzp	UTSW	6	128490072	missense	probably damaging	0.99
R5697:Pzp	UTSW	6	128525189	missense	probably benign	0.03
R5854:Pzp	UTSW	6	128506869	missense	probably benign	0.01
R5994:Pzp	UTSW	6	128491597	missense	probably damaging	1.00
R6042:Pzp	UTSW	6	128524014	missense	possibly damaging	0.75
R6054:Pzp	UTSW	6	128513764	missense	probably benign	0.03
R6153:Pzp	UTSW	6	128489016	missense	probably benign
R6719:Pzp	UTSW	6	128524083	missense	probably benign	0.17
R6722:Pzp	UTSW	6	128487954	missense	probably damaging	1.00
R7316:Pzp	UTSW	6	128513773	missense	probably damaging	0.99
R7453:Pzp	UTSW	6	128486916	missense	probably damaging	1.00
R7826:Pzp	UTSW	6	128487533	missense	probably benign	0.38

Predicted Primers

PCR Primer
(F):5'- ATCTTAACCAAGAAGAAGGCACTG -3'
(R):5'- GATGTCGTCTCTTGCCATTCAG -3'

Sequencing Primer
(F):5'- CACTGGGAAATGTTGGTAAAGTTGC -3'
(R):5'- CTGTGTGTCCTGGAGCCATC -3'

Posted On

2018-05-21