Incidental Mutation 'R6430:Cep350'
ID518468
Institutional Source Beutler Lab
Gene Symbol Cep350
Ensembl Gene ENSMUSG00000033671
Gene Namecentrosomal protein 350
Synonyms6430546F08Rik, 4933409L06Rik
MMRRC Submission
Accession Numbers

Genbank: NM_001039184.1; Ensembl: ENSMUST00000138762, ENSMUST00000124495, ENSMUST00000078888

Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R6430 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location155844964-155973255 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 155894673 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1824 (S1824P)
Ref Sequence ENSEMBL: ENSMUSP00000120085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000138762]
Predicted Effect probably benign
Transcript: ENSMUST00000129865
Predicted Effect probably damaging
Transcript: ENSMUST00000138762
AA Change: S1824P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120085
Gene: ENSMUSG00000033671
AA Change: S1824P

DomainStartEndE-ValueType
low complexity region 251 265 N/A INTRINSIC
low complexity region 376 394 N/A INTRINSIC
low complexity region 481 491 N/A INTRINSIC
coiled coil region 596 641 N/A INTRINSIC
low complexity region 659 669 N/A INTRINSIC
low complexity region 701 719 N/A INTRINSIC
low complexity region 754 763 N/A INTRINSIC
low complexity region 979 994 N/A INTRINSIC
low complexity region 1153 1175 N/A INTRINSIC
low complexity region 1250 1267 N/A INTRINSIC
coiled coil region 1363 1402 N/A INTRINSIC
low complexity region 1517 1531 N/A INTRINSIC
low complexity region 1536 1546 N/A INTRINSIC
low complexity region 1694 1714 N/A INTRINSIC
coiled coil region 1732 1794 N/A INTRINSIC
low complexity region 1800 1811 N/A INTRINSIC
low complexity region 1819 1835 N/A INTRINSIC
coiled coil region 1853 1893 N/A INTRINSIC
low complexity region 1980 1994 N/A INTRINSIC
coiled coil region 2042 2092 N/A INTRINSIC
low complexity region 2383 2394 N/A INTRINSIC
low complexity region 2409 2421 N/A INTRINSIC
low complexity region 2470 2482 N/A INTRINSIC
CAP_GLY 2486 2551 5.91e-31 SMART
coiled coil region 2700 2731 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a large protein with a CAP-Gly domain typically found in cytoskeleton-associated proteins. The encoded protein primarily localizes to the centrosome, a non-membraneous organelle that functions as the major microtubule-organizing center in animal cells. The encoded protein directly interacts with another large centrosomal protein and is required to anchor microtubules at the centrosome. It is also implicated in the regulation of a class of nuclear hormone receptors in the nucleus. Several alternatively spliced transcript variants have been found, but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI

 All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI661453 C A 17: 47,466,797 probably benign Het
Als2cr12 T A 1: 58,678,289 K154N probably damaging Het
Ank1 T A 8: 23,132,109 L1513Q probably damaging Het
Ap2a1 C A 7: 44,903,829 V676L probably benign Het
Arid2 T C 15: 96,363,694 V477A probably benign Het
Auh C A 13: 52,929,410 G17C probably benign Het
B3gnt7 T C 1: 86,306,117 F362L possibly damaging Het
Cd207 C T 6: 83,675,887 R87H probably benign Het
Cdyl A G 13: 35,871,606 K503R possibly damaging Het
Cmas T A 6: 142,767,924 M225K probably benign Het
Dhx29 T C 13: 112,944,619 S396P possibly damaging Het
Epg5 T C 18: 77,975,885 S958P probably damaging Het
Espnl T C 1: 91,322,248 L39P possibly damaging Het
Fuk A G 8: 110,884,116 V915A probably benign Het
Gatb A G 3: 85,637,038 N438D probably benign Het
Hspg2 T C 4: 137,539,396 C1932R probably damaging Het
Jmjd1c C T 10: 67,224,160 T662I possibly damaging Het
Kcng4 A G 8: 119,633,050 S196P probably damaging Het
Kcnh7 T G 2: 62,850,532 H237P probably benign Het
Klhl38 T C 15: 58,322,311 T341A probably benign Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Man2c1 T C 9: 57,131,233 V59A possibly damaging Het
Nr2c1 A T 10: 94,195,341 H588L possibly damaging Het
Olfr137 T C 17: 38,305,358 I34M probably benign Het
Olfr305 A T 7: 86,363,973 Y121* probably null Het
Osbpl6 A G 2: 76,579,276 E494G probably damaging Het
Per1 T C 11: 69,104,296 L638S probably damaging Het
Plekhn1 T C 4: 156,221,804 E603G probably benign Het
Prss12 A T 3: 123,479,594 S280C probably damaging Het
Pudp A G 18: 50,568,236 I142T probably benign Het
Rabl6 A T 2: 25,584,837 N620K probably damaging Het
Rttn T A 18: 89,021,685 C837S probably null Het
Slc16a7 A G 10: 125,231,018 S251P probably damaging Het
Slc7a10 A G 7: 35,197,658 I195V probably benign Het
Slc9a4 A T 1: 40,600,854 R269* probably null Het
Slco6c1 T A 1: 97,075,974 Q466L probably benign Het
Smc6 A G 12: 11,309,234 N953S probably benign Het
Tex15 T C 8: 33,571,301 V527A probably benign Het
Tln2 T C 9: 67,272,665 Y808C probably damaging Het
Tmem145 T C 7: 25,309,038 L289P possibly damaging Het
Trim3 A G 7: 105,618,005 V389A probably benign Het
Vmn1r3 G A 4: 3,184,971 T112I probably benign Het
Vps11 C A 9: 44,361,550 A28S probably benign Het
Zbtb41 T A 1: 139,447,207 S802T probably benign Het
Zmynd10 A T 9: 107,548,712 K82* probably null Het
Other mutations in Cep350
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Cep350 APN 1 155940746 missense possibly damaging 0.68
IGL00821:Cep350 APN 1 155862204 missense probably benign
IGL00837:Cep350 APN 1 155953391 missense probably damaging 1.00
IGL00977:Cep350 APN 1 155932865 missense probably null 0.99
IGL01544:Cep350 APN 1 155953187 missense probably damaging 1.00
IGL01616:Cep350 APN 1 155953247 missense probably benign 0.00
IGL01695:Cep350 APN 1 155944158 missense probably damaging 1.00
IGL01902:Cep350 APN 1 155861985 missense probably damaging 1.00
IGL01977:Cep350 APN 1 155911968 missense probably benign 0.01
IGL02388:Cep350 APN 1 155953753 missense probably benign 0.28
IGL02475:Cep350 APN 1 155862595 missense probably damaging 1.00
IGL02528:Cep350 APN 1 155894615 missense probably damaging 1.00
IGL02598:Cep350 APN 1 155862967 missense probably benign 0.00
IGL02676:Cep350 APN 1 155862231 missense possibly damaging 0.82
IGL02728:Cep350 APN 1 155953222 missense probably benign 0.02
IGL02744:Cep350 APN 1 155931533 missense probably damaging 0.98
IGL02817:Cep350 APN 1 155928842 missense probably damaging 1.00
IGL02892:Cep350 APN 1 155868806 missense possibly damaging 0.51
IGL03156:Cep350 APN 1 155858042 missense probably damaging 1.00
IGL03166:Cep350 APN 1 155863600 missense possibly damaging 0.78
IGL03216:Cep350 APN 1 155860627 missense probably benign 0.06
IGL03268:Cep350 APN 1 155953549 missense probably benign 0.16
IGL03358:Cep350 APN 1 155928539 missense probably benign
NA:Cep350 UTSW 1 155958648 missense probably damaging 1.00
R0060:Cep350 UTSW 1 155928626 missense probably damaging 1.00
R0060:Cep350 UTSW 1 155928626 missense probably damaging 1.00
R0066:Cep350 UTSW 1 155911218 missense probably damaging 0.99
R0066:Cep350 UTSW 1 155911218 missense probably damaging 0.99
R0172:Cep350 UTSW 1 155953447 missense probably benign 0.00
R0365:Cep350 UTSW 1 155906571 missense probably benign 0.00
R0472:Cep350 UTSW 1 155914723 missense probably damaging 0.99
R0502:Cep350 UTSW 1 155900883 splice site probably null
R0538:Cep350 UTSW 1 155848620 missense possibly damaging 0.80
R0547:Cep350 UTSW 1 155901435 splice site probably null
R0565:Cep350 UTSW 1 155961195 splice site probably benign
R0607:Cep350 UTSW 1 155872048 missense probably damaging 1.00
R0645:Cep350 UTSW 1 155940712 splice site probably null
R0675:Cep350 UTSW 1 155959753 missense possibly damaging 0.63
R0828:Cep350 UTSW 1 155953246 missense probably benign 0.00
R0863:Cep350 UTSW 1 155862235 missense probably benign 0.00
R0969:Cep350 UTSW 1 155940826 missense possibly damaging 0.81
R1102:Cep350 UTSW 1 155931518 missense probably damaging 1.00
R1186:Cep350 UTSW 1 155875376 missense probably damaging 1.00
R1552:Cep350 UTSW 1 155910738 missense possibly damaging 0.92
R1560:Cep350 UTSW 1 155929079 missense possibly damaging 0.48
R1698:Cep350 UTSW 1 155953358 missense possibly damaging 0.62
R1729:Cep350 UTSW 1 155911981 missense probably benign 0.17
R1735:Cep350 UTSW 1 155953214 missense probably damaging 0.99
R1740:Cep350 UTSW 1 155928833 missense probably damaging 1.00
R1783:Cep350 UTSW 1 155928865 missense probably damaging 1.00
R1844:Cep350 UTSW 1 155848628 missense probably damaging 0.99
R1848:Cep350 UTSW 1 155953651 missense probably benign 0.28
R1988:Cep350 UTSW 1 155933104 missense possibly damaging 0.82
R2008:Cep350 UTSW 1 155914721 missense probably benign 0.16
R2241:Cep350 UTSW 1 155958556 splice site probably null
R2245:Cep350 UTSW 1 155879020 missense probably benign 0.10
R2402:Cep350 UTSW 1 155863136 missense probably benign
R2566:Cep350 UTSW 1 155959718 critical splice donor site probably null
R3160:Cep350 UTSW 1 155863164 missense probably benign 0.00
R3162:Cep350 UTSW 1 155863164 missense probably benign 0.00
R3769:Cep350 UTSW 1 155953204 missense probably damaging 1.00
R4035:Cep350 UTSW 1 155959795 missense probably benign 0.06
R4158:Cep350 UTSW 1 155932875 missense probably damaging 1.00
R4160:Cep350 UTSW 1 155932875 missense probably damaging 1.00
R4213:Cep350 UTSW 1 155935961 missense probably damaging 1.00
R4483:Cep350 UTSW 1 155926468 missense probably benign 0.01
R4648:Cep350 UTSW 1 155902598 missense possibly damaging 0.85
R4694:Cep350 UTSW 1 155928586 missense probably damaging 1.00
R4836:Cep350 UTSW 1 155928833 missense probably damaging 1.00
R4839:Cep350 UTSW 1 155928494 missense probably benign 0.00
R4969:Cep350 UTSW 1 155860279 missense probably damaging 0.99
R5014:Cep350 UTSW 1 155928206 missense probably benign 0.00
R5027:Cep350 UTSW 1 155933354 missense probably benign 0.01
R5144:Cep350 UTSW 1 155911150 missense probably damaging 0.99
R5153:Cep350 UTSW 1 155935946 missense probably damaging 1.00
R5165:Cep350 UTSW 1 155928368 missense probably damaging 1.00
R5182:Cep350 UTSW 1 155858108 missense probably damaging 1.00
R5445:Cep350 UTSW 1 155894723 missense probably benign 0.01
R5738:Cep350 UTSW 1 155866078 missense probably damaging 1.00
R5809:Cep350 UTSW 1 155933341 missense probably damaging 0.98
R5855:Cep350 UTSW 1 155953762 missense probably benign 0.00
R6103:Cep350 UTSW 1 155924576 missense probably benign 0.05
R6139:Cep350 UTSW 1 155953279 missense probably benign 0.03
R6285:Cep350 UTSW 1 155953374 missense possibly damaging 0.48
R6446:Cep350 UTSW 1 155862154 missense probably benign
R6520:Cep350 UTSW 1 155933336 missense probably benign 0.02
R6712:Cep350 UTSW 1 155858106 missense possibly damaging 0.93
R6940:Cep350 UTSW 1 155928551 missense probably benign 0.01
R7020:Cep350 UTSW 1 155928331 missense probably damaging 1.00
R7056:Cep350 UTSW 1 155848627 missense probably damaging 1.00
R7141:Cep350 UTSW 1 155914748 missense probably damaging 1.00
R7215:Cep350 UTSW 1 155894707 missense possibly damaging 0.89
R7247:Cep350 UTSW 1 155910753 missense probably damaging 1.00
R7272:Cep350 UTSW 1 155953588 missense probably damaging 0.98
R7336:Cep350 UTSW 1 155862276 missense probably benign 0.17
R7361:Cep350 UTSW 1 155901491 missense probably damaging 1.00
R7390:Cep350 UTSW 1 155866087 missense possibly damaging 0.94
R7402:Cep350 UTSW 1 155928215 missense probably benign 0.00
R7428:Cep350 UTSW 1 155894619 missense probably benign 0.00
R7440:Cep350 UTSW 1 155940772 missense probably damaging 0.98
R7520:Cep350 UTSW 1 155915629 missense probably benign 0.05
R7529:Cep350 UTSW 1 155861923 missense probably benign 0.08
R7635:Cep350 UTSW 1 155879021 nonsense probably null
R7806:Cep350 UTSW 1 155862063 missense probably benign 0.00
R8100:Cep350 UTSW 1 155953402 missense probably damaging 0.97
RF020:Cep350 UTSW 1 155915478 missense probably benign 0.34
X0018:Cep350 UTSW 1 155953286 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- GGCTGTCTAGATAATCTAGTAATCTGC -3'
(R):5'- CACACTACTTTTAAGTATGCGATGG -3'

Sequencing Primer
(F):5'- AGTAATCTGCTAACACATTCTCTCTC -3'
(R):5'- AAGTATGCGATGGATTTCTGTTC -3'
Posted On2018-05-24