Incidental Mutation 'R7215:Cep350'
ID 561359
Institutional Source Beutler Lab
Gene Symbol Cep350
Ensembl Gene ENSMUSG00000033671
Gene Name centrosomal protein 350
Synonyms 4933409L06Rik, 6430546F08Rik
MMRRC Submission 045287-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.963) question?
Stock # R7215 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 155720710-155849001 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 155770453 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 1812 (S1812R)
Ref Sequence ENSEMBL: ENSMUSP00000120085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000138762]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000129865
Predicted Effect possibly damaging
Transcript: ENSMUST00000138762
AA Change: S1812R

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000120085
Gene: ENSMUSG00000033671
AA Change: S1812R

DomainStartEndE-ValueType
low complexity region 251 265 N/A INTRINSIC
low complexity region 376 394 N/A INTRINSIC
low complexity region 481 491 N/A INTRINSIC
coiled coil region 596 641 N/A INTRINSIC
low complexity region 659 669 N/A INTRINSIC
low complexity region 701 719 N/A INTRINSIC
low complexity region 754 763 N/A INTRINSIC
low complexity region 979 994 N/A INTRINSIC
low complexity region 1153 1175 N/A INTRINSIC
low complexity region 1250 1267 N/A INTRINSIC
coiled coil region 1363 1402 N/A INTRINSIC
low complexity region 1517 1531 N/A INTRINSIC
low complexity region 1536 1546 N/A INTRINSIC
low complexity region 1694 1714 N/A INTRINSIC
coiled coil region 1732 1794 N/A INTRINSIC
low complexity region 1800 1811 N/A INTRINSIC
low complexity region 1819 1835 N/A INTRINSIC
coiled coil region 1853 1893 N/A INTRINSIC
low complexity region 1980 1994 N/A INTRINSIC
coiled coil region 2042 2092 N/A INTRINSIC
low complexity region 2383 2394 N/A INTRINSIC
low complexity region 2409 2421 N/A INTRINSIC
low complexity region 2470 2482 N/A INTRINSIC
CAP_GLY 2486 2551 5.91e-31 SMART
coiled coil region 2700 2731 N/A INTRINSIC
Meta Mutation Damage Score 0.0611 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (79/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a large protein with a CAP-Gly domain typically found in cytoskeleton-associated proteins. The encoded protein primarily localizes to the centrosome, a non-membraneous organelle that functions as the major microtubule-organizing center in animal cells. The encoded protein directly interacts with another large centrosomal protein and is required to anchor microtubules at the centrosome. It is also implicated in the regulation of a class of nuclear hormone receptors in the nucleus. Several alternatively spliced transcript variants have been found, but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI

 All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik G A 13: 77,471,690 (GRCm39) V1032M possibly damaging Het
Abca13 T A 11: 9,238,405 (GRCm39) probably null Het
Adamts14 T A 10: 61,047,375 (GRCm39) H739L possibly damaging Het
Adgrl3 A G 5: 81,841,397 (GRCm39) E758G probably damaging Het
Ano3 T A 2: 110,496,277 (GRCm39) T826S probably damaging Het
Arhgap45 C T 10: 79,861,316 (GRCm39) T493I possibly damaging Het
Atg9b A C 5: 24,593,039 (GRCm39) W455G probably damaging Het
Atp4a A G 7: 30,416,785 (GRCm39) N496S possibly damaging Het
Bckdk T A 7: 127,504,282 (GRCm39) D60E possibly damaging Het
Blmh A T 11: 76,856,725 (GRCm39) K244* probably null Het
Btbd17 T C 11: 114,682,291 (GRCm39) I474V possibly damaging Het
C87436 A G 6: 86,439,662 (GRCm39) E451G possibly damaging Het
Camta1 T C 4: 151,229,194 (GRCm39) E546G probably damaging Het
Casp1 A G 9: 5,298,523 (GRCm39) probably null Het
Ccdc116 A G 16: 16,957,792 (GRCm39) Y456H probably damaging Het
Chrna10 A G 7: 101,761,415 (GRCm39) L392P possibly damaging Het
Col22a1 A T 15: 71,842,181 (GRCm39) C434* probably null Het
Cxcl9 G A 5: 92,471,747 (GRCm39) Q98* probably null Het
Cyp2c54 G A 19: 40,034,626 (GRCm39) T348I probably damaging Het
Dnah7a G A 1: 53,657,509 (GRCm39) R756C probably damaging Het
Dnajc18 T C 18: 35,815,034 (GRCm39) T239A probably benign Het
Dnase2a A T 8: 85,636,399 (GRCm39) probably null Het
Dpyd A G 3: 119,059,681 (GRCm39) T793A probably benign Het
Edil3 T C 13: 88,970,169 (GRCm39) probably null Het
Ehd1 T A 19: 6,347,672 (GRCm39) I342N possibly damaging Het
Erbb4 A T 1: 68,378,619 (GRCm39) S341T probably benign Het
Ezh1 T A 11: 101,106,125 (GRCm39) T87S probably benign Het
Fam20b A T 1: 156,518,123 (GRCm39) W224R probably damaging Het
Galns A T 8: 123,326,087 (GRCm39) probably null Het
Gm13283 C T 4: 88,678,967 (GRCm39) probably benign Het
Gm49342 A T 14: 51,182,040 (GRCm39) M23L probably benign Het
Gm5114 T A 7: 39,060,795 (GRCm39) H18L probably benign Het
Gpr89 A G 3: 96,787,404 (GRCm39) W299R probably damaging Het
Hadha G T 5: 30,324,840 (GRCm39) N755K probably benign Het
Inpp5d A T 1: 87,628,940 (GRCm39) H620L probably benign Het
Klk1b3 T A 7: 43,849,828 (GRCm39) probably null Het
Macf1 T C 4: 123,401,097 (GRCm39) T663A probably damaging Het
Man1b1 A G 2: 25,240,402 (GRCm39) N601S probably benign Het
Mbtps1 A G 8: 120,251,307 (GRCm39) V605A possibly damaging Het
Med23 C G 10: 24,764,327 (GRCm39) D311E probably benign Het
Myo3a G T 2: 22,250,378 (GRCm39) D82Y possibly damaging Het
Nsd1 T A 13: 55,395,454 (GRCm39) D1121E probably benign Het
Odad1 C T 7: 45,586,046 (GRCm39) R148C probably damaging Het
Or4c116 G A 2: 88,942,845 (GRCm39) Q4* probably null Het
Or5al1 C T 2: 85,989,800 (GRCm39) V305I probably benign Het
Or8b3b A G 9: 38,584,743 (GRCm39) I12T probably benign Het
Otoa T C 7: 120,717,795 (GRCm39) V19A unknown Het
Pcdhb20 A T 18: 37,638,439 (GRCm39) T322S probably benign Het
Pecam1 T C 11: 106,586,745 (GRCm39) T257A probably benign Het
Pi16 G T 17: 29,538,072 (GRCm39) probably benign Het
Pik3c2g C T 6: 139,700,589 (GRCm39) T293M Het
Pira13 C T 7: 3,825,310 (GRCm39) C444Y unknown Het
Pkhd1l1 T A 15: 44,391,559 (GRCm39) C1542S possibly damaging Het
Prrc2b G A 2: 32,119,309 (GRCm39) G2172R probably damaging Het
Prrt1 A T 17: 34,848,677 (GRCm39) probably null Het
Ptprb T A 10: 116,174,681 (GRCm39) N784K possibly damaging Het
Rem1 C A 2: 152,470,069 (GRCm39) S18R probably damaging Het
Ripk4 G A 16: 97,548,523 (GRCm39) probably null Het
Scn8a G A 15: 100,927,711 (GRCm39) V1397I possibly damaging Het
Setbp1 T A 18: 78,900,052 (GRCm39) H1205L probably damaging Het
Shmt1 T C 11: 60,692,361 (GRCm39) I132V probably damaging Het
Slc24a1 T A 9: 64,835,785 (GRCm39) T781S unknown Het
Sncaip C T 18: 53,040,415 (GRCm39) Q870* probably null Het
Stab1 A T 14: 30,882,754 (GRCm39) N416K possibly damaging Het
Tcea1 A G 1: 4,937,706 (GRCm39) D26G probably damaging Het
Tcf20 A T 15: 82,737,690 (GRCm39) S1254T probably benign Het
Tead4 T A 6: 128,205,641 (GRCm39) I354F probably damaging Het
Tex36 G A 7: 133,189,147 (GRCm39) R142* probably null Het
Trav6d-3 T A 14: 52,962,799 (GRCm39) L12Q probably damaging Het
Trpc4 A G 3: 54,102,317 (GRCm39) T72A possibly damaging Het
Trrap G A 5: 144,733,945 (GRCm39) A933T probably benign Het
Tspoap1 T A 11: 87,661,315 (GRCm39) I589N probably benign Het
Ttll5 T A 12: 85,980,170 (GRCm39) V918E probably benign Het
Tut4 T C 4: 108,384,205 (GRCm39) Y1091H probably damaging Het
Txn2 A G 15: 77,811,886 (GRCm39) probably null Het
Ucn3 T G 13: 3,991,365 (GRCm39) T96P probably benign Het
Usp36 T C 11: 118,155,980 (GRCm39) E764G possibly damaging Het
Vmn2r23 A T 6: 123,681,323 (GRCm39) H77L probably benign Het
Vmn2r57 T C 7: 41,049,710 (GRCm39) T680A probably benign Het
Vwa3a T C 7: 120,394,853 (GRCm39) I891T possibly damaging Het
Zfp764l1 A G 7: 126,990,695 (GRCm39) S431P probably benign Het
Zhx2 A G 15: 57,687,039 (GRCm39) I803V probably benign Het
Other mutations in Cep350
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Cep350 APN 1 155,816,492 (GRCm39) missense possibly damaging 0.68
IGL00821:Cep350 APN 1 155,737,950 (GRCm39) missense probably benign
IGL00837:Cep350 APN 1 155,829,137 (GRCm39) missense probably damaging 1.00
IGL00977:Cep350 APN 1 155,808,611 (GRCm39) missense probably null 0.99
IGL01544:Cep350 APN 1 155,828,933 (GRCm39) missense probably damaging 1.00
IGL01616:Cep350 APN 1 155,828,993 (GRCm39) missense probably benign 0.00
IGL01695:Cep350 APN 1 155,819,904 (GRCm39) missense probably damaging 1.00
IGL01902:Cep350 APN 1 155,737,731 (GRCm39) missense probably damaging 1.00
IGL01977:Cep350 APN 1 155,787,714 (GRCm39) missense probably benign 0.01
IGL02388:Cep350 APN 1 155,829,499 (GRCm39) missense probably benign 0.28
IGL02475:Cep350 APN 1 155,738,341 (GRCm39) missense probably damaging 1.00
IGL02528:Cep350 APN 1 155,770,361 (GRCm39) missense probably damaging 1.00
IGL02598:Cep350 APN 1 155,738,713 (GRCm39) missense probably benign 0.00
IGL02676:Cep350 APN 1 155,737,977 (GRCm39) missense possibly damaging 0.82
IGL02728:Cep350 APN 1 155,828,968 (GRCm39) missense probably benign 0.02
IGL02744:Cep350 APN 1 155,807,279 (GRCm39) missense probably damaging 0.98
IGL02817:Cep350 APN 1 155,804,588 (GRCm39) missense probably damaging 1.00
IGL02892:Cep350 APN 1 155,744,552 (GRCm39) missense possibly damaging 0.51
IGL03156:Cep350 APN 1 155,733,788 (GRCm39) missense probably damaging 1.00
IGL03166:Cep350 APN 1 155,739,346 (GRCm39) missense possibly damaging 0.78
IGL03216:Cep350 APN 1 155,736,373 (GRCm39) missense probably benign 0.06
IGL03268:Cep350 APN 1 155,829,295 (GRCm39) missense probably benign 0.16
IGL03358:Cep350 APN 1 155,804,285 (GRCm39) missense probably benign
primed UTSW 1 155,829,334 (GRCm39) missense probably damaging 0.98
stoked UTSW 1 155,791,321 (GRCm39) missense probably benign 0.03
NA:Cep350 UTSW 1 155,834,394 (GRCm39) missense probably damaging 1.00
R0060:Cep350 UTSW 1 155,804,372 (GRCm39) missense probably damaging 1.00
R0060:Cep350 UTSW 1 155,804,372 (GRCm39) missense probably damaging 1.00
R0066:Cep350 UTSW 1 155,786,964 (GRCm39) missense probably damaging 0.99
R0066:Cep350 UTSW 1 155,786,964 (GRCm39) missense probably damaging 0.99
R0172:Cep350 UTSW 1 155,829,193 (GRCm39) missense probably benign 0.00
R0365:Cep350 UTSW 1 155,782,317 (GRCm39) missense probably benign 0.00
R0472:Cep350 UTSW 1 155,790,469 (GRCm39) missense probably damaging 0.99
R0502:Cep350 UTSW 1 155,776,629 (GRCm39) splice site probably null
R0538:Cep350 UTSW 1 155,724,366 (GRCm39) missense possibly damaging 0.80
R0547:Cep350 UTSW 1 155,777,181 (GRCm39) splice site probably null
R0565:Cep350 UTSW 1 155,836,941 (GRCm39) splice site probably benign
R0607:Cep350 UTSW 1 155,747,794 (GRCm39) missense probably damaging 1.00
R0645:Cep350 UTSW 1 155,816,458 (GRCm39) splice site probably null
R0675:Cep350 UTSW 1 155,835,499 (GRCm39) missense possibly damaging 0.63
R0828:Cep350 UTSW 1 155,828,992 (GRCm39) missense probably benign 0.00
R0863:Cep350 UTSW 1 155,737,981 (GRCm39) missense probably benign 0.00
R0969:Cep350 UTSW 1 155,816,572 (GRCm39) missense possibly damaging 0.81
R1102:Cep350 UTSW 1 155,807,264 (GRCm39) missense probably damaging 1.00
R1186:Cep350 UTSW 1 155,751,122 (GRCm39) missense probably damaging 1.00
R1552:Cep350 UTSW 1 155,786,484 (GRCm39) missense possibly damaging 0.92
R1560:Cep350 UTSW 1 155,804,825 (GRCm39) missense possibly damaging 0.48
R1698:Cep350 UTSW 1 155,829,104 (GRCm39) missense possibly damaging 0.62
R1729:Cep350 UTSW 1 155,787,727 (GRCm39) missense probably benign 0.17
R1735:Cep350 UTSW 1 155,828,960 (GRCm39) missense probably damaging 0.99
R1740:Cep350 UTSW 1 155,804,579 (GRCm39) missense probably damaging 1.00
R1783:Cep350 UTSW 1 155,804,611 (GRCm39) missense probably damaging 1.00
R1844:Cep350 UTSW 1 155,724,374 (GRCm39) missense probably damaging 0.99
R1848:Cep350 UTSW 1 155,829,397 (GRCm39) missense probably benign 0.28
R1988:Cep350 UTSW 1 155,808,850 (GRCm39) missense possibly damaging 0.82
R2008:Cep350 UTSW 1 155,790,467 (GRCm39) missense probably benign 0.16
R2241:Cep350 UTSW 1 155,834,302 (GRCm39) splice site probably null
R2245:Cep350 UTSW 1 155,754,766 (GRCm39) missense probably benign 0.10
R2402:Cep350 UTSW 1 155,738,882 (GRCm39) missense probably benign
R2566:Cep350 UTSW 1 155,835,464 (GRCm39) critical splice donor site probably null
R3160:Cep350 UTSW 1 155,738,910 (GRCm39) missense probably benign 0.00
R3162:Cep350 UTSW 1 155,738,910 (GRCm39) missense probably benign 0.00
R3769:Cep350 UTSW 1 155,828,950 (GRCm39) missense probably damaging 1.00
R4035:Cep350 UTSW 1 155,835,541 (GRCm39) missense probably benign 0.06
R4158:Cep350 UTSW 1 155,808,621 (GRCm39) missense probably damaging 1.00
R4160:Cep350 UTSW 1 155,808,621 (GRCm39) missense probably damaging 1.00
R4213:Cep350 UTSW 1 155,811,707 (GRCm39) missense probably damaging 1.00
R4483:Cep350 UTSW 1 155,802,214 (GRCm39) missense probably benign 0.01
R4648:Cep350 UTSW 1 155,778,344 (GRCm39) missense possibly damaging 0.85
R4694:Cep350 UTSW 1 155,804,332 (GRCm39) missense probably damaging 1.00
R4836:Cep350 UTSW 1 155,804,579 (GRCm39) missense probably damaging 1.00
R4839:Cep350 UTSW 1 155,804,240 (GRCm39) missense probably benign 0.00
R4969:Cep350 UTSW 1 155,736,025 (GRCm39) missense probably damaging 0.99
R5014:Cep350 UTSW 1 155,803,952 (GRCm39) missense probably benign 0.00
R5027:Cep350 UTSW 1 155,809,100 (GRCm39) missense probably benign 0.01
R5144:Cep350 UTSW 1 155,786,896 (GRCm39) missense probably damaging 0.99
R5153:Cep350 UTSW 1 155,811,692 (GRCm39) missense probably damaging 1.00
R5165:Cep350 UTSW 1 155,804,114 (GRCm39) missense probably damaging 1.00
R5182:Cep350 UTSW 1 155,733,854 (GRCm39) missense probably damaging 1.00
R5445:Cep350 UTSW 1 155,770,469 (GRCm39) missense probably benign 0.01
R5738:Cep350 UTSW 1 155,741,824 (GRCm39) missense probably damaging 1.00
R5809:Cep350 UTSW 1 155,809,087 (GRCm39) missense probably damaging 0.98
R5855:Cep350 UTSW 1 155,829,508 (GRCm39) missense probably benign 0.00
R6103:Cep350 UTSW 1 155,800,322 (GRCm39) missense probably benign 0.05
R6139:Cep350 UTSW 1 155,829,025 (GRCm39) missense probably benign 0.03
R6285:Cep350 UTSW 1 155,829,120 (GRCm39) missense possibly damaging 0.48
R6430:Cep350 UTSW 1 155,770,419 (GRCm39) missense probably damaging 1.00
R6446:Cep350 UTSW 1 155,737,900 (GRCm39) missense probably benign
R6520:Cep350 UTSW 1 155,809,082 (GRCm39) missense probably benign 0.02
R6712:Cep350 UTSW 1 155,733,852 (GRCm39) missense possibly damaging 0.93
R6940:Cep350 UTSW 1 155,804,297 (GRCm39) missense probably benign 0.01
R7020:Cep350 UTSW 1 155,804,077 (GRCm39) missense probably damaging 1.00
R7056:Cep350 UTSW 1 155,724,373 (GRCm39) missense probably damaging 1.00
R7141:Cep350 UTSW 1 155,790,494 (GRCm39) missense probably damaging 1.00
R7247:Cep350 UTSW 1 155,786,499 (GRCm39) missense probably damaging 1.00
R7272:Cep350 UTSW 1 155,829,334 (GRCm39) missense probably damaging 0.98
R7336:Cep350 UTSW 1 155,738,022 (GRCm39) missense probably benign 0.17
R7361:Cep350 UTSW 1 155,777,237 (GRCm39) missense probably damaging 1.00
R7390:Cep350 UTSW 1 155,741,833 (GRCm39) missense possibly damaging 0.94
R7402:Cep350 UTSW 1 155,803,961 (GRCm39) missense probably benign 0.00
R7428:Cep350 UTSW 1 155,770,365 (GRCm39) missense probably benign 0.00
R7440:Cep350 UTSW 1 155,816,518 (GRCm39) missense probably damaging 0.98
R7520:Cep350 UTSW 1 155,791,375 (GRCm39) missense probably benign 0.05
R7529:Cep350 UTSW 1 155,737,669 (GRCm39) missense probably benign 0.08
R7635:Cep350 UTSW 1 155,754,767 (GRCm39) nonsense probably null
R7806:Cep350 UTSW 1 155,737,809 (GRCm39) missense probably benign 0.00
R8100:Cep350 UTSW 1 155,829,148 (GRCm39) missense probably damaging 0.97
R8192:Cep350 UTSW 1 155,816,529 (GRCm39) missense possibly damaging 0.94
R8193:Cep350 UTSW 1 155,737,825 (GRCm39) missense probably benign 0.01
R8351:Cep350 UTSW 1 155,747,780 (GRCm39) missense probably damaging 0.99
R8406:Cep350 UTSW 1 155,798,164 (GRCm39) missense probably benign 0.00
R8451:Cep350 UTSW 1 155,747,780 (GRCm39) missense probably damaging 0.99
R8467:Cep350 UTSW 1 155,791,321 (GRCm39) missense probably benign 0.03
R8543:Cep350 UTSW 1 155,738,122 (GRCm39) missense probably damaging 0.98
R8714:Cep350 UTSW 1 155,736,477 (GRCm39) missense probably damaging 0.98
R8810:Cep350 UTSW 1 155,803,862 (GRCm39) missense probably damaging 1.00
R8837:Cep350 UTSW 1 155,737,518 (GRCm39) missense probably benign 0.09
R8933:Cep350 UTSW 1 155,739,161 (GRCm39) missense probably benign 0.01
R9043:Cep350 UTSW 1 155,773,228 (GRCm39) missense probably damaging 1.00
R9050:Cep350 UTSW 1 155,738,687 (GRCm39) missense possibly damaging 0.81
R9067:Cep350 UTSW 1 155,737,485 (GRCm39) missense probably benign 0.00
R9105:Cep350 UTSW 1 155,835,561 (GRCm39) missense probably damaging 1.00
R9295:Cep350 UTSW 1 155,738,051 (GRCm39) nonsense probably null
R9304:Cep350 UTSW 1 155,829,464 (GRCm39) missense probably damaging 0.98
R9456:Cep350 UTSW 1 155,744,457 (GRCm39) missense probably benign 0.00
R9575:Cep350 UTSW 1 155,751,113 (GRCm39) missense probably benign 0.03
R9715:Cep350 UTSW 1 155,751,107 (GRCm39) missense probably benign 0.00
R9749:Cep350 UTSW 1 155,828,985 (GRCm39) missense probably benign 0.02
R9758:Cep350 UTSW 1 155,770,433 (GRCm39) missense probably damaging 0.96
R9767:Cep350 UTSW 1 155,739,018 (GRCm39) missense probably benign 0.01
RF020:Cep350 UTSW 1 155,791,224 (GRCm39) missense probably benign 0.34
X0018:Cep350 UTSW 1 155,829,032 (GRCm39) missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- GGCTGTCTAGATAATCTAGTAATCTGC -3'
(R):5'- CCACACTACTTTTAAGTATGCGATG -3'

Sequencing Primer
(F):5'- AGTAATCTGCTAACACATTCTCTCTC -3'
(R):5'- AAGTATGCGATGGATTTCTGTTC -3'
Posted On 2019-06-26