Incidental Mutation 'R7361:Cep350'
ID571298
Institutional Source Beutler Lab
Gene Symbol Cep350
Ensembl Gene ENSMUSG00000033671
Gene Namecentrosomal protein 350
Synonyms6430546F08Rik, 4933409L06Rik
Accession Numbers

Genbank: NM_001039184.1; Ensembl: ENSMUST00000138762, ENSMUST00000124495, ENSMUST00000078888

Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R7361 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location155844964-155973255 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 155901491 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 1701 (A1701V)
Ref Sequence ENSEMBL: ENSMUSP00000120085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000138762]
Predicted Effect probably damaging
Transcript: ENSMUST00000138762
AA Change: A1701V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120085
Gene: ENSMUSG00000033671
AA Change: A1701V

DomainStartEndE-ValueType
low complexity region 251 265 N/A INTRINSIC
low complexity region 376 394 N/A INTRINSIC
low complexity region 481 491 N/A INTRINSIC
coiled coil region 596 641 N/A INTRINSIC
low complexity region 659 669 N/A INTRINSIC
low complexity region 701 719 N/A INTRINSIC
low complexity region 754 763 N/A INTRINSIC
low complexity region 979 994 N/A INTRINSIC
low complexity region 1153 1175 N/A INTRINSIC
low complexity region 1250 1267 N/A INTRINSIC
coiled coil region 1363 1402 N/A INTRINSIC
low complexity region 1517 1531 N/A INTRINSIC
low complexity region 1536 1546 N/A INTRINSIC
low complexity region 1694 1714 N/A INTRINSIC
coiled coil region 1732 1794 N/A INTRINSIC
low complexity region 1800 1811 N/A INTRINSIC
low complexity region 1819 1835 N/A INTRINSIC
coiled coil region 1853 1893 N/A INTRINSIC
low complexity region 1980 1994 N/A INTRINSIC
coiled coil region 2042 2092 N/A INTRINSIC
low complexity region 2383 2394 N/A INTRINSIC
low complexity region 2409 2421 N/A INTRINSIC
low complexity region 2470 2482 N/A INTRINSIC
CAP_GLY 2486 2551 5.91e-31 SMART
coiled coil region 2700 2731 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a large protein with a CAP-Gly domain typically found in cytoskeleton-associated proteins. The encoded protein primarily localizes to the centrosome, a non-membraneous organelle that functions as the major microtubule-organizing center in animal cells. The encoded protein directly interacts with another large centrosomal protein and is required to anchor microtubules at the centrosome. It is also implicated in the regulation of a class of nuclear hormone receptors in the nucleus. Several alternatively spliced transcript variants have been found, but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI

 All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik C T 6: 132,627,471 V4I unknown Het
Actn1 A T 12: 80,193,715 D199E probably benign Het
Adam17 T C 12: 21,325,601 D739G probably damaging Het
Agmat T C 4: 141,746,852 S15P probably benign Het
Ahsa2 A G 11: 23,491,099 S229P probably damaging Het
Arhgef3 A G 14: 27,265,578 D36G possibly damaging Het
BC055324 A T 1: 163,986,033 D207E possibly damaging Het
C6 C A 15: 4,796,922 Y662* probably null Het
Ccs T C 19: 4,833,350 D140G probably benign Het
Cdc42bpb A G 12: 111,345,605 L65P probably damaging Het
Cdh24 A T 14: 54,638,921 V149E possibly damaging Het
Cdk12 C A 11: 98,210,468 S384* probably null Het
Ces1g T C 8: 93,333,679 Q104R not run Het
Chd5 A G 4: 152,363,288 H537R probably damaging Het
Cln5 T A 14: 103,075,903 V197D probably damaging Het
Coq7 A G 7: 118,529,575 V79A probably benign Het
Cp A T 3: 19,964,306 N58I probably benign Het
Cplx2 A T 13: 54,378,826 M16L probably benign Het
Crot A G 5: 8,977,534 L266S probably damaging Het
Ctbs T A 3: 146,458,754 Y221N probably damaging Het
Cul7 T A 17: 46,657,007 L707Q probably damaging Het
D430041D05Rik G A 2: 104,255,018 T378I possibly damaging Het
Dixdc1 T C 9: 50,688,653 I364V probably damaging Het
Dnah11 T A 12: 118,018,742 H2564L probably damaging Het
Dnajc3 T C 14: 118,938,164 Y26H probably benign Het
Dpysl2 G A 14: 66,834,215 H159Y possibly damaging Het
Ehmt1 T A 2: 24,856,701 K423I possibly damaging Het
Enpp7 A G 11: 118,992,159 N353S probably benign Het
Ext1 G A 15: 53,344,723 A214V probably damaging Het
Fbxo18 A T 2: 11,747,076 I937N probably damaging Het
Fbxo39 T C 11: 72,316,974 Y51H possibly damaging Het
Fry A G 5: 150,436,847 H1986R possibly damaging Het
Gm2022 A G 12: 87,895,400 N11D unknown Het
Grem2 T C 1: 174,836,948 K112E probably benign Het
Gucy1a1 A G 3: 82,097,720 V586A probably damaging Het
Il12rb2 G T 6: 67,303,466 L586I possibly damaging Het
Il18 T C 9: 50,579,314 I83T probably damaging Het
Irs1 A T 1: 82,289,114 Y460* probably null Het
Jak1 G T 4: 101,184,339 Q161K possibly damaging Het
Jakmip1 T A 5: 37,118,804 L486Q probably damaging Het
Jmjd1c C A 10: 67,218,364 Q16K probably benign Het
Kidins220 T C 12: 25,057,000 L1393P probably benign Het
Klhl24 A C 16: 20,118,000 I453L probably benign Het
Krtap2-4 C T 11: 99,614,594 D64N probably damaging Het
Man1a T A 10: 53,908,009 D592V probably damaging Het
Mepe T A 5: 104,337,143 Y50N probably benign Het
Mier3 G A 13: 111,705,249 G115S possibly damaging Het
Muc4 T A 16: 32,754,670 S1515T probably benign Het
Nalcn T C 14: 123,291,839 D1408G probably benign Het
Nav1 T C 1: 135,452,853 M1443V unknown Het
Nckap1l A C 15: 103,471,282 N332T possibly damaging Het
Neurl4 T A 11: 69,912,079 L1467Q probably benign Het
Notch2 A G 3: 98,131,402 N1287S probably benign Het
Nr4a3 C T 4: 48,083,203 P579S probably benign Het
Nrxn2 A T 19: 6,517,082 H1329L probably benign Het
Nynrin A T 14: 55,870,400 H988L possibly damaging Het
Olfr1183 A G 2: 88,461,492 T70A probably benign Het
Olfr140 A G 2: 90,051,745 I193T probably benign Het
Olfr394 T A 11: 73,888,001 I124F probably damaging Het
Olfr594 G T 7: 103,220,623 D302Y possibly damaging Het
Olfr855 T A 9: 19,584,560 F8I probably benign Het
Pclo G A 5: 14,793,868 S1534N probably damaging Het
Pign A G 1: 105,585,053 V635A probably benign Het
Pkhd1 T C 1: 20,593,953 T134A probably damaging Het
Plcb4 A T 2: 135,976,148 N790I possibly damaging Het
Plxna2 G T 1: 194,799,779 C1453F probably damaging Het
Plxna4 A G 6: 32,196,122 probably null Het
Pnpla2 A G 7: 141,457,431 I116V possibly damaging Het
Polq A G 16: 37,060,428 T985A probably benign Het
Ppp1r32 T G 19: 10,479,579 D134A probably damaging Het
Pramef6 T C 4: 143,895,886 T300A possibly damaging Het
Prex1 T C 2: 166,713,570 N50S probably benign Het
Ptgfrn G A 3: 101,077,444 A144V probably benign Het
Rad54b G A 4: 11,599,782 G329S probably damaging Het
Rrbp1 A G 2: 143,967,444 L931S probably benign Het
Sipa1l2 A G 8: 125,453,332 S1109P probably damaging Het
Slc26a7 G T 4: 14,546,305 N341K probably damaging Het
Smg1 A C 7: 118,184,977 D958E unknown Het
Smg6 T A 11: 74,930,153 S417T probably benign Het
Srgap3 A G 6: 112,746,921 V550A probably damaging Het
Terb1 T A 8: 104,468,799 D570V probably damaging Het
Tet3 A G 6: 83,368,094 V1787A probably benign Het
Tor1a A T 2: 30,963,741 D192E probably benign Het
Tpr T C 1: 150,447,621 S2379P possibly damaging Het
Trip12 A T 1: 84,750,442 F1138L probably damaging Het
Trpv1 T C 11: 73,260,377 L797P probably damaging Het
Tut1 T C 19: 8,965,334 L595P probably damaging Het
Ubl7 T C 9: 57,914,622 S85P probably damaging Het
Urb1 C A 16: 90,774,768 S1051I probably damaging Het
Usp17le A G 7: 104,768,877 W353R probably damaging Het
Usp44 T C 10: 93,846,468 L260S probably benign Het
Wsb1 T A 11: 79,240,797 probably null Het
Xrcc2 A T 5: 25,692,757 C65S probably damaging Het
Zfp316 T A 5: 143,254,675 M530L probably benign Het
Zfp473 T C 7: 44,733,139 H590R probably damaging Het
Zfp983 T A 17: 21,661,934 H259Q probably damaging Het
Other mutations in Cep350
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Cep350 APN 1 155940746 missense possibly damaging 0.68
IGL00821:Cep350 APN 1 155862204 missense probably benign
IGL00837:Cep350 APN 1 155953391 missense probably damaging 1.00
IGL00977:Cep350 APN 1 155932865 missense probably null 0.99
IGL01544:Cep350 APN 1 155953187 missense probably damaging 1.00
IGL01616:Cep350 APN 1 155953247 missense probably benign 0.00
IGL01695:Cep350 APN 1 155944158 missense probably damaging 1.00
IGL01902:Cep350 APN 1 155861985 missense probably damaging 1.00
IGL01977:Cep350 APN 1 155911968 missense probably benign 0.01
IGL02388:Cep350 APN 1 155953753 missense probably benign 0.28
IGL02475:Cep350 APN 1 155862595 missense probably damaging 1.00
IGL02528:Cep350 APN 1 155894615 missense probably damaging 1.00
IGL02598:Cep350 APN 1 155862967 missense probably benign 0.00
IGL02676:Cep350 APN 1 155862231 missense possibly damaging 0.82
IGL02728:Cep350 APN 1 155953222 missense probably benign 0.02
IGL02744:Cep350 APN 1 155931533 missense probably damaging 0.98
IGL02817:Cep350 APN 1 155928842 missense probably damaging 1.00
IGL02892:Cep350 APN 1 155868806 missense possibly damaging 0.51
IGL03156:Cep350 APN 1 155858042 missense probably damaging 1.00
IGL03166:Cep350 APN 1 155863600 missense possibly damaging 0.78
IGL03216:Cep350 APN 1 155860627 missense probably benign 0.06
IGL03268:Cep350 APN 1 155953549 missense probably benign 0.16
IGL03358:Cep350 APN 1 155928539 missense probably benign
NA:Cep350 UTSW 1 155958648 missense probably damaging 1.00
R0060:Cep350 UTSW 1 155928626 missense probably damaging 1.00
R0060:Cep350 UTSW 1 155928626 missense probably damaging 1.00
R0066:Cep350 UTSW 1 155911218 missense probably damaging 0.99
R0066:Cep350 UTSW 1 155911218 missense probably damaging 0.99
R0172:Cep350 UTSW 1 155953447 missense probably benign 0.00
R0365:Cep350 UTSW 1 155906571 missense probably benign 0.00
R0472:Cep350 UTSW 1 155914723 missense probably damaging 0.99
R0502:Cep350 UTSW 1 155900883 splice site probably null
R0538:Cep350 UTSW 1 155848620 missense possibly damaging 0.80
R0547:Cep350 UTSW 1 155901435 splice site probably null
R0565:Cep350 UTSW 1 155961195 splice site probably benign
R0607:Cep350 UTSW 1 155872048 missense probably damaging 1.00
R0645:Cep350 UTSW 1 155940712 splice site probably null
R0675:Cep350 UTSW 1 155959753 missense possibly damaging 0.63
R0828:Cep350 UTSW 1 155953246 missense probably benign 0.00
R0863:Cep350 UTSW 1 155862235 missense probably benign 0.00
R0969:Cep350 UTSW 1 155940826 missense possibly damaging 0.81
R1102:Cep350 UTSW 1 155931518 missense probably damaging 1.00
R1186:Cep350 UTSW 1 155875376 missense probably damaging 1.00
R1552:Cep350 UTSW 1 155910738 missense possibly damaging 0.92
R1560:Cep350 UTSW 1 155929079 missense possibly damaging 0.48
R1698:Cep350 UTSW 1 155953358 missense possibly damaging 0.62
R1729:Cep350 UTSW 1 155911981 missense probably benign 0.17
R1735:Cep350 UTSW 1 155953214 missense probably damaging 0.99
R1740:Cep350 UTSW 1 155928833 missense probably damaging 1.00
R1783:Cep350 UTSW 1 155928865 missense probably damaging 1.00
R1844:Cep350 UTSW 1 155848628 missense probably damaging 0.99
R1848:Cep350 UTSW 1 155953651 missense probably benign 0.28
R1988:Cep350 UTSW 1 155933104 missense possibly damaging 0.82
R2008:Cep350 UTSW 1 155914721 missense probably benign 0.16
R2241:Cep350 UTSW 1 155958556 splice site probably null
R2245:Cep350 UTSW 1 155879020 missense probably benign 0.10
R2402:Cep350 UTSW 1 155863136 missense probably benign
R2566:Cep350 UTSW 1 155959718 critical splice donor site probably null
R3160:Cep350 UTSW 1 155863164 missense probably benign 0.00
R3162:Cep350 UTSW 1 155863164 missense probably benign 0.00
R3769:Cep350 UTSW 1 155953204 missense probably damaging 1.00
R4035:Cep350 UTSW 1 155959795 missense probably benign 0.06
R4158:Cep350 UTSW 1 155932875 missense probably damaging 1.00
R4160:Cep350 UTSW 1 155932875 missense probably damaging 1.00
R4213:Cep350 UTSW 1 155935961 missense probably damaging 1.00
R4483:Cep350 UTSW 1 155926468 missense probably benign 0.01
R4648:Cep350 UTSW 1 155902598 missense possibly damaging 0.85
R4694:Cep350 UTSW 1 155928586 missense probably damaging 1.00
R4836:Cep350 UTSW 1 155928833 missense probably damaging 1.00
R4839:Cep350 UTSW 1 155928494 missense probably benign 0.00
R4969:Cep350 UTSW 1 155860279 missense probably damaging 0.99
R5014:Cep350 UTSW 1 155928206 missense probably benign 0.00
R5027:Cep350 UTSW 1 155933354 missense probably benign 0.01
R5144:Cep350 UTSW 1 155911150 missense probably damaging 0.99
R5153:Cep350 UTSW 1 155935946 missense probably damaging 1.00
R5165:Cep350 UTSW 1 155928368 missense probably damaging 1.00
R5182:Cep350 UTSW 1 155858108 missense probably damaging 1.00
R5445:Cep350 UTSW 1 155894723 missense probably benign 0.01
R5738:Cep350 UTSW 1 155866078 missense probably damaging 1.00
R5809:Cep350 UTSW 1 155933341 missense probably damaging 0.98
R5855:Cep350 UTSW 1 155953762 missense probably benign 0.00
R6103:Cep350 UTSW 1 155924576 missense probably benign 0.05
R6139:Cep350 UTSW 1 155953279 missense probably benign 0.03
R6285:Cep350 UTSW 1 155953374 missense possibly damaging 0.48
R6430:Cep350 UTSW 1 155894673 missense probably damaging 1.00
R6446:Cep350 UTSW 1 155862154 missense probably benign
R6520:Cep350 UTSW 1 155933336 missense probably benign 0.02
R6712:Cep350 UTSW 1 155858106 missense possibly damaging 0.93
R6940:Cep350 UTSW 1 155928551 missense probably benign 0.01
R7020:Cep350 UTSW 1 155928331 missense probably damaging 1.00
R7056:Cep350 UTSW 1 155848627 missense probably damaging 1.00
R7141:Cep350 UTSW 1 155914748 missense probably damaging 1.00
R7215:Cep350 UTSW 1 155894707 missense possibly damaging 0.89
R7247:Cep350 UTSW 1 155910753 missense probably damaging 1.00
R7272:Cep350 UTSW 1 155953588 missense probably damaging 0.98
R7336:Cep350 UTSW 1 155862276 missense probably benign 0.17
R7390:Cep350 UTSW 1 155866087 missense possibly damaging 0.94
R7402:Cep350 UTSW 1 155928215 missense probably benign 0.00
R7428:Cep350 UTSW 1 155894619 missense probably benign 0.00
R7440:Cep350 UTSW 1 155940772 missense probably damaging 0.98
R7520:Cep350 UTSW 1 155915629 missense probably benign 0.05
R7529:Cep350 UTSW 1 155861923 missense probably benign 0.08
X0018:Cep350 UTSW 1 155953286 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- GTTTAGCATTCACCAAACCCAGG -3'
(R):5'- TCATGTGACCCCACCGTATC -3'

Sequencing Primer
(F):5'- ACCCAGGTTTGATTCCCAAC -3'
(R):5'- ATGTGACCCCACCGTATCTTTTG -3'
Posted On2019-09-13