Incidental Mutation 'R8810:Cep350'
ID 672315
Institutional Source Beutler Lab
Gene Symbol Cep350
Ensembl Gene ENSMUSG00000033671
Gene Name centrosomal protein 350
Synonyms 6430546F08Rik, 4933409L06Rik
MMRRC Submission
Accession Numbers

Genbank: NM_001039184.1; Ensembl: ENSMUST00000138762, ENSMUST00000124495, ENSMUST00000078888
Essential gene? Probably essential (E-score: 0.959) question?
Stock # R8810 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 155844964-155973255 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 155928116 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 1074 (K1074E)
Ref Sequence ENSEMBL: ENSMUSP00000120085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000138762]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000138762
AA Change: K1074E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120085
Gene: ENSMUSG00000033671
AA Change: K1074E

DomainStartEndE-ValueType
low complexity region 251 265 N/A INTRINSIC
low complexity region 376 394 N/A INTRINSIC
low complexity region 481 491 N/A INTRINSIC
coiled coil region 596 641 N/A INTRINSIC
low complexity region 659 669 N/A INTRINSIC
low complexity region 701 719 N/A INTRINSIC
low complexity region 754 763 N/A INTRINSIC
low complexity region 979 994 N/A INTRINSIC
low complexity region 1153 1175 N/A INTRINSIC
low complexity region 1250 1267 N/A INTRINSIC
coiled coil region 1363 1402 N/A INTRINSIC
low complexity region 1517 1531 N/A INTRINSIC
low complexity region 1536 1546 N/A INTRINSIC
low complexity region 1694 1714 N/A INTRINSIC
coiled coil region 1732 1794 N/A INTRINSIC
low complexity region 1800 1811 N/A INTRINSIC
low complexity region 1819 1835 N/A INTRINSIC
coiled coil region 1853 1893 N/A INTRINSIC
low complexity region 1980 1994 N/A INTRINSIC
coiled coil region 2042 2092 N/A INTRINSIC
low complexity region 2383 2394 N/A INTRINSIC
low complexity region 2409 2421 N/A INTRINSIC
low complexity region 2470 2482 N/A INTRINSIC
CAP_GLY 2486 2551 5.91e-31 SMART
coiled coil region 2700 2731 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency 99% (82/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a large protein with a CAP-Gly domain typically found in cytoskeleton-associated proteins. The encoded protein primarily localizes to the centrosome, a non-membraneous organelle that functions as the major microtubule-organizing center in animal cells. The encoded protein directly interacts with another large centrosomal protein and is required to anchor microtubules at the centrosome. It is also implicated in the regulation of a class of nuclear hormone receptors in the nucleus. Several alternatively spliced transcript variants have been found, but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI

 All alleles(5) : Gene trapped(5)
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan T C 7: 79,099,704 S1408P probably damaging Het
Acap3 T C 4: 155,905,712 V783A probably damaging Het
Akap8 T C 17: 32,306,530 N525S probably damaging Het
Aqp1 C T 6: 55,336,621 T44M probably damaging Het
Arap1 T C 7: 101,404,378 Y1305H probably damaging Het
Atg2a T G 19: 6,250,621 S743A probably benign Het
AW551984 G T 9: 39,600,011 L133I probably damaging Het
Bahcc1 C A 11: 120,273,761 P802T possibly damaging Het
Brd8 C A 18: 34,609,949 V288L probably benign Het
Carmil2 T C 8: 105,686,315 probably null Het
Catspere2 G A 1: 178,077,482 E153K possibly damaging Het
Ccdc162 C T 10: 41,666,741 R379Q probably benign Het
Cdh16 A G 8: 104,614,504 L116P probably damaging Het
Cenpj A T 14: 56,558,619 H260Q possibly damaging Het
Cenpq A G 17: 40,933,136 V17A possibly damaging Het
Chil4 C A 3: 106,201,805 C394F probably damaging Het
Chst9 T C 18: 15,717,926 I28V probably benign Het
Clasp2 C A 9: 113,899,581 N873K probably damaging Het
Clec4b2 T A 6: 123,181,310 M45K probably benign Het
Cmya5 T A 13: 93,063,540 T3427S possibly damaging Het
Cnih4 A G 1: 181,162,212 Y130C probably damaging Het
Cpne9 T A 6: 113,304,545 M529K probably damaging Het
Ctsr T A 13: 61,161,825 Y190F probably damaging Het
Cyp2j13 G A 4: 96,056,916 H351Y probably benign Het
Dixdc1 T A 9: 50,701,965 Q230L probably damaging Het
Dpep1 A T 8: 123,200,025 I226F probably benign Het
Ehd2 A G 7: 15,957,678 V243A probably benign Het
Etnk2 T A 1: 133,378,494 Y353N probably benign Het
Fgg G T 3: 83,013,015 G367V probably damaging Het
Gm11639 A T 11: 104,914,895 N3076I unknown Het
Gm609 T C 16: 45,443,836 T120A probably benign Het
Gm9772 T C 17: 22,006,329 *61Q probably null Het
Grk5 T G 19: 61,089,994 D496E possibly damaging Het
Hc T C 2: 35,019,523 N915S probably benign Het
Iah1 G T 12: 21,317,387 Q31H probably benign Het
Insr T C 8: 3,169,714 D936G probably benign Het
Ints6 A C 14: 62,702,453 V596G probably benign Het
Ispd A T 12: 36,390,482 N130Y probably damaging Het
Kcnj16 A G 11: 111,024,851 D113G possibly damaging Het
Kdm4b A T 17: 56,399,771 I928F probably damaging Het
Lrrc41 C T 4: 116,075,291 probably benign Het
Lrrc8e G A 8: 4,235,070 V432I probably benign Het
Mamdc4 T C 2: 25,568,489 E336G probably benign Het
Maml2 C A 9: 13,621,622 Q711K Het
Map3k14 T C 11: 103,227,672 T563A possibly damaging Het
Mcu T A 10: 59,467,713 K101* probably null Het
Mettl22 T A 16: 8,485,928 V286E probably damaging Het
Mon2 A T 10: 123,009,611 N1396K possibly damaging Het
Mprip T C 11: 59,697,025 probably benign Het
Mrpl51 C T 6: 125,193,381 L117F probably damaging Het
Myo1d C A 11: 80,674,932 V356F probably damaging Het
Myo1d T A 11: 80,676,932 I241F probably benign Het
Naalad2 A T 9: 18,385,934 probably benign Het
Nacad T C 11: 6,602,853 T113A probably benign Het
Nrap T A 19: 56,364,411 probably benign Het
Olfr1134 T C 2: 87,656,247 I225V possibly damaging Het
Olfr1336 T C 7: 6,460,764 L85P probably damaging Het
Olfr1358 G A 10: 78,520,450 V281M possibly damaging Het
Olfr290 T A 7: 84,916,418 I213N possibly damaging Het
Olfr30 T C 11: 58,455,110 T280A possibly damaging Het
Olfr661 T A 7: 104,688,180 I55N probably damaging Het
Osbpl3 T C 6: 50,351,872 D117G probably damaging Het
Parp9 C T 16: 35,953,611 R318* probably null Het
Pcdhb18 A G 18: 37,490,321 I235V probably benign Het
Pex16 T G 2: 92,379,021 probably benign Het
Piezo2 T A 18: 63,114,963 M489L probably benign Het
Pmepa1 C A 2: 173,227,835 G271V probably damaging Het
Safb A G 17: 56,603,579 E659G unknown Het
Scn9a T C 2: 66,501,666 T1289A probably damaging Het
Secisbp2l T C 2: 125,775,676 D27G possibly damaging Het
Serpina1f A G 12: 103,693,981 V14A probably benign Het
Serpinb9b C A 13: 33,029,469 T3N possibly damaging Het
Sfxn5 C T 6: 85,229,200 M315I probably benign Het
Slc9b2 A G 3: 135,329,769 D333G probably benign Het
Sostdc1 A G 12: 36,317,230 N135S possibly damaging Het
Spg11 T G 2: 122,070,944 D1505A probably damaging Het
Taar7a T C 10: 23,993,381 N34S probably benign Het
Tcerg1l C A 7: 138,209,797 R556L possibly damaging Het
Tcp11l1 T C 2: 104,688,418 K311R probably benign Het
Tepp A T 8: 95,321,255 probably benign Het
Trbv16 T G 6: 41,152,038 F52C probably damaging Het
Ttn T A 2: 76,895,672 R6073S unknown Het
Uba1y T C Y: 828,818 I542T possibly damaging Het
Vmn1r214 T C 13: 23,034,912 I192T probably benign Het
Vmn2r67 C T 7: 85,137,138 C553Y probably damaging Het
Zdhhc17 G T 10: 110,948,260 H452N possibly damaging Het
Other mutations in Cep350
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Cep350 APN 1 155940746 missense possibly damaging 0.68
IGL00821:Cep350 APN 1 155862204 missense probably benign
IGL00837:Cep350 APN 1 155953391 missense probably damaging 1.00
IGL00977:Cep350 APN 1 155932865 missense probably null 0.99
IGL01544:Cep350 APN 1 155953187 missense probably damaging 1.00
IGL01616:Cep350 APN 1 155953247 missense probably benign 0.00
IGL01695:Cep350 APN 1 155944158 missense probably damaging 1.00
IGL01902:Cep350 APN 1 155861985 missense probably damaging 1.00
IGL01977:Cep350 APN 1 155911968 missense probably benign 0.01
IGL02388:Cep350 APN 1 155953753 missense probably benign 0.28
IGL02475:Cep350 APN 1 155862595 missense probably damaging 1.00
IGL02528:Cep350 APN 1 155894615 missense probably damaging 1.00
IGL02598:Cep350 APN 1 155862967 missense probably benign 0.00
IGL02676:Cep350 APN 1 155862231 missense possibly damaging 0.82
IGL02728:Cep350 APN 1 155953222 missense probably benign 0.02
IGL02744:Cep350 APN 1 155931533 missense probably damaging 0.98
IGL02817:Cep350 APN 1 155928842 missense probably damaging 1.00
IGL02892:Cep350 APN 1 155868806 missense possibly damaging 0.51
IGL03156:Cep350 APN 1 155858042 missense probably damaging 1.00
IGL03166:Cep350 APN 1 155863600 missense possibly damaging 0.78
IGL03216:Cep350 APN 1 155860627 missense probably benign 0.06
IGL03268:Cep350 APN 1 155953549 missense probably benign 0.16
IGL03358:Cep350 APN 1 155928539 missense probably benign
primed UTSW 1 155953588 missense probably damaging 0.98
stoked UTSW 1 155915575 missense probably benign 0.03
NA:Cep350 UTSW 1 155958648 missense probably damaging 1.00
R0060:Cep350 UTSW 1 155928626 missense probably damaging 1.00
R0060:Cep350 UTSW 1 155928626 missense probably damaging 1.00
R0066:Cep350 UTSW 1 155911218 missense probably damaging 0.99
R0066:Cep350 UTSW 1 155911218 missense probably damaging 0.99
R0172:Cep350 UTSW 1 155953447 missense probably benign 0.00
R0365:Cep350 UTSW 1 155906571 missense probably benign 0.00
R0472:Cep350 UTSW 1 155914723 missense probably damaging 0.99
R0502:Cep350 UTSW 1 155900883 splice site probably null
R0538:Cep350 UTSW 1 155848620 missense possibly damaging 0.80
R0547:Cep350 UTSW 1 155901435 splice site probably null
R0565:Cep350 UTSW 1 155961195 splice site probably benign
R0607:Cep350 UTSW 1 155872048 missense probably damaging 1.00
R0645:Cep350 UTSW 1 155940712 splice site probably null
R0675:Cep350 UTSW 1 155959753 missense possibly damaging 0.63
R0828:Cep350 UTSW 1 155953246 missense probably benign 0.00
R0863:Cep350 UTSW 1 155862235 missense probably benign 0.00
R0969:Cep350 UTSW 1 155940826 missense possibly damaging 0.81
R1102:Cep350 UTSW 1 155931518 missense probably damaging 1.00
R1186:Cep350 UTSW 1 155875376 missense probably damaging 1.00
R1552:Cep350 UTSW 1 155910738 missense possibly damaging 0.92
R1560:Cep350 UTSW 1 155929079 missense possibly damaging 0.48
R1698:Cep350 UTSW 1 155953358 missense possibly damaging 0.62
R1729:Cep350 UTSW 1 155911981 missense probably benign 0.17
R1735:Cep350 UTSW 1 155953214 missense probably damaging 0.99
R1740:Cep350 UTSW 1 155928833 missense probably damaging 1.00
R1783:Cep350 UTSW 1 155928865 missense probably damaging 1.00
R1844:Cep350 UTSW 1 155848628 missense probably damaging 0.99
R1848:Cep350 UTSW 1 155953651 missense probably benign 0.28
R1988:Cep350 UTSW 1 155933104 missense possibly damaging 0.82
R2008:Cep350 UTSW 1 155914721 missense probably benign 0.16
R2241:Cep350 UTSW 1 155958556 splice site probably null
R2245:Cep350 UTSW 1 155879020 missense probably benign 0.10
R2402:Cep350 UTSW 1 155863136 missense probably benign
R2566:Cep350 UTSW 1 155959718 critical splice donor site probably null
R3160:Cep350 UTSW 1 155863164 missense probably benign 0.00
R3162:Cep350 UTSW 1 155863164 missense probably benign 0.00
R3769:Cep350 UTSW 1 155953204 missense probably damaging 1.00
R4035:Cep350 UTSW 1 155959795 missense probably benign 0.06
R4158:Cep350 UTSW 1 155932875 missense probably damaging 1.00
R4160:Cep350 UTSW 1 155932875 missense probably damaging 1.00
R4213:Cep350 UTSW 1 155935961 missense probably damaging 1.00
R4483:Cep350 UTSW 1 155926468 missense probably benign 0.01
R4648:Cep350 UTSW 1 155902598 missense possibly damaging 0.85
R4694:Cep350 UTSW 1 155928586 missense probably damaging 1.00
R4836:Cep350 UTSW 1 155928833 missense probably damaging 1.00
R4839:Cep350 UTSW 1 155928494 missense probably benign 0.00
R4969:Cep350 UTSW 1 155860279 missense probably damaging 0.99
R5014:Cep350 UTSW 1 155928206 missense probably benign 0.00
R5027:Cep350 UTSW 1 155933354 missense probably benign 0.01
R5144:Cep350 UTSW 1 155911150 missense probably damaging 0.99
R5153:Cep350 UTSW 1 155935946 missense probably damaging 1.00
R5165:Cep350 UTSW 1 155928368 missense probably damaging 1.00
R5182:Cep350 UTSW 1 155858108 missense probably damaging 1.00
R5445:Cep350 UTSW 1 155894723 missense probably benign 0.01
R5738:Cep350 UTSW 1 155866078 missense probably damaging 1.00
R5809:Cep350 UTSW 1 155933341 missense probably damaging 0.98
R5855:Cep350 UTSW 1 155953762 missense probably benign 0.00
R6103:Cep350 UTSW 1 155924576 missense probably benign 0.05
R6139:Cep350 UTSW 1 155953279 missense probably benign 0.03
R6285:Cep350 UTSW 1 155953374 missense possibly damaging 0.48
R6430:Cep350 UTSW 1 155894673 missense probably damaging 1.00
R6446:Cep350 UTSW 1 155862154 missense probably benign
R6520:Cep350 UTSW 1 155933336 missense probably benign 0.02
R6712:Cep350 UTSW 1 155858106 missense possibly damaging 0.93
R6940:Cep350 UTSW 1 155928551 missense probably benign 0.01
R7020:Cep350 UTSW 1 155928331 missense probably damaging 1.00
R7056:Cep350 UTSW 1 155848627 missense probably damaging 1.00
R7141:Cep350 UTSW 1 155914748 missense probably damaging 1.00
R7215:Cep350 UTSW 1 155894707 missense possibly damaging 0.89
R7247:Cep350 UTSW 1 155910753 missense probably damaging 1.00
R7272:Cep350 UTSW 1 155953588 missense probably damaging 0.98
R7336:Cep350 UTSW 1 155862276 missense probably benign 0.17
R7361:Cep350 UTSW 1 155901491 missense probably damaging 1.00
R7390:Cep350 UTSW 1 155866087 missense possibly damaging 0.94
R7402:Cep350 UTSW 1 155928215 missense probably benign 0.00
R7428:Cep350 UTSW 1 155894619 missense probably benign 0.00
R7440:Cep350 UTSW 1 155940772 missense probably damaging 0.98
R7520:Cep350 UTSW 1 155915629 missense probably benign 0.05
R7529:Cep350 UTSW 1 155861923 missense probably benign 0.08
R7635:Cep350 UTSW 1 155879021 nonsense probably null
R7806:Cep350 UTSW 1 155862063 missense probably benign 0.00
R8100:Cep350 UTSW 1 155953402 missense probably damaging 0.97
R8192:Cep350 UTSW 1 155940783 missense possibly damaging 0.94
R8193:Cep350 UTSW 1 155862079 missense probably benign 0.01
R8351:Cep350 UTSW 1 155872034 missense probably damaging 0.99
R8406:Cep350 UTSW 1 155922418 missense probably benign 0.00
R8451:Cep350 UTSW 1 155872034 missense probably damaging 0.99
R8467:Cep350 UTSW 1 155915575 missense probably benign 0.03
R8543:Cep350 UTSW 1 155862376 missense probably damaging 0.98
R8714:Cep350 UTSW 1 155860731 missense probably damaging 0.98
R8837:Cep350 UTSW 1 155861772 missense probably benign 0.09
R8933:Cep350 UTSW 1 155863415 missense probably benign 0.01
R9043:Cep350 UTSW 1 155897482 missense probably damaging 1.00
R9050:Cep350 UTSW 1 155862941 missense possibly damaging 0.81
R9067:Cep350 UTSW 1 155861739 missense probably benign 0.00
R9105:Cep350 UTSW 1 155959815 missense probably damaging 1.00
R9295:Cep350 UTSW 1 155862305 nonsense probably null
R9304:Cep350 UTSW 1 155953718 missense probably damaging 0.98
R9456:Cep350 UTSW 1 155868711 missense probably benign 0.00
R9575:Cep350 UTSW 1 155875367 missense probably benign 0.03
R9715:Cep350 UTSW 1 155875361 missense probably benign 0.00
R9749:Cep350 UTSW 1 155953239 missense probably benign 0.02
R9758:Cep350 UTSW 1 155894687 missense probably damaging 0.96
R9767:Cep350 UTSW 1 155863272 missense probably benign 0.01
RF020:Cep350 UTSW 1 155915478 missense probably benign 0.34
X0018:Cep350 UTSW 1 155953286 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- ACAGATGAAACCAACTCATTTGTC -3'
(R):5'- GGGAGAGAAACTCTTATGAACCCATC -3'

Sequencing Primer
(F):5'- AGTGAAAATCTACAACCTAGGAATTC -3'
(R):5'- ATGAACCCATCAAAGAGTTTCAG -3'
Posted On 2021-04-30