Incidental Mutation 'R6531:4930590J08Rik'
ID 522347
Institutional Source Beutler Lab
Gene Symbol 4930590J08Rik
Ensembl Gene ENSMUSG00000034063
Gene Name RIKEN cDNA 4930590J08 gene
Synonyms LOC381798
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6531 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 91902809-91950725 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 91949999 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 880 (E880G)
Ref Sequence ENSEMBL: ENSMUSP00000146101 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059318] [ENSMUST00000205686]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000059318
AA Change: E880G

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000053778
Gene: ENSMUSG00000034063
AA Change: E880G

DomainStartEndE-ValueType
low complexity region 89 109 N/A INTRINSIC
Pfam:FAM194 357 561 4.1e-68 PFAM
low complexity region 626 637 N/A INTRINSIC
transmembrane domain 774 796 N/A INTRINSIC
low complexity region 891 909 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205569
Predicted Effect possibly damaging
Transcript: ENSMUST00000205686
AA Change: E880G

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.2%
  • 20x: 90.6%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg2 T A 17: 56,846,617 I529F probably damaging Het
Ahcyl2 T G 6: 29,886,162 M359R probably benign Het
Aldh5a1 G T 13: 24,918,564 D305E probably benign Het
Catsper2 C G 2: 121,399,780 V358L possibly damaging Het
Cd200r4 C T 16: 44,833,505 Q222* probably null Het
Col4a2 T A 8: 11,408,135 D270E probably benign Het
Cux1 T C 5: 136,275,119 D1401G probably benign Het
Cyp3a59 T A 5: 146,098,217 M235K probably benign Het
Dock3 T C 9: 106,967,216 D895G probably benign Het
Dusp27 A T 1: 166,110,046 probably null Het
Dync1h1 T C 12: 110,617,920 F586L probably damaging Het
Elmo1 G T 13: 20,572,446 R568L possibly damaging Het
Epb41 T C 4: 131,957,636 T711A probably benign Het
Grm7 T A 6: 111,358,425 M599K probably benign Het
Hivep3 A T 4: 120,122,876 K1704* probably null Het
Ighv1-62-3 C A 12: 115,461,006 C115F probably damaging Het
Krt78 A G 15: 101,952,273 Y200H probably benign Het
Lamb2 A T 9: 108,483,726 H549L possibly damaging Het
Mroh3 A G 1: 136,184,353 I759T probably benign Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Nol6 G T 4: 41,118,154 P828T probably benign Het
Olfr1030 A G 2: 85,984,307 I156V probably benign Het
Olfr1132 A G 2: 87,635,529 Y73H probably damaging Het
Olfr1264 A G 2: 90,021,457 V203A probably benign Het
Olfr344 G A 2: 36,569,341 V248I probably damaging Het
Ovgp1 A C 3: 105,987,071 probably benign Het
Pitpnm3 T A 11: 72,071,487 Q230L possibly damaging Het
Pkn1 C T 8: 83,670,293 V910I probably benign Het
Plcb1 T A 2: 135,325,802 probably null Het
Ppp1r12c A G 7: 4,482,789 probably null Het
Rassf5 T A 1: 131,244,814 Q106L possibly damaging Het
Rfc1 T C 5: 65,312,979 K62E possibly damaging Het
Sf3b1 C T 1: 55,019,395 E12K probably damaging Het
Slc4a1ap A T 5: 31,548,638 D691V probably benign Het
Speg T A 1: 75,422,757 F2283I probably benign Het
Synj2 A G 17: 6,033,839 K267E probably damaging Het
Tg A T 15: 66,839,362 Y991F probably damaging Het
Tlk1 A T 2: 70,742,083 D380E probably benign Het
Trim43b A T 9: 89,085,365 L405H probably damaging Het
Ttf2 A G 3: 100,956,260 I586T probably damaging Het
Ugt2b36 T A 5: 87,081,586 R213S probably damaging Het
Vmn1r198 T A 13: 22,354,407 M21K probably benign Het
Wdr35 A T 12: 8,978,685 Y101F probably benign Het
Zfp367 T C 13: 64,144,250 Y189C probably damaging Het
Other mutations in 4930590J08Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:4930590J08Rik APN 6 91919118 missense possibly damaging 0.74
IGL01478:4930590J08Rik APN 6 91934609 missense probably benign 0.01
IGL01481:4930590J08Rik APN 6 91933098 missense probably damaging 1.00
IGL01485:4930590J08Rik APN 6 91950022 missense probably damaging 0.96
IGL01794:4930590J08Rik APN 6 91918112 nonsense probably null
IGL01795:4930590J08Rik APN 6 91918112 nonsense probably null
IGL02040:4930590J08Rik APN 6 91918110 missense probably benign
IGL02171:4930590J08Rik APN 6 91944256 missense probably benign 0.01
IGL02968:4930590J08Rik APN 6 91923473 missense probably damaging 1.00
IGL03358:4930590J08Rik APN 6 91928735 missense probably damaging 1.00
PIT4519001:4930590J08Rik UTSW 6 91917057 missense probably damaging 1.00
R0531:4930590J08Rik UTSW 6 91915146 missense probably benign
R0569:4930590J08Rik UTSW 6 91942578 nonsense probably null
R1536:4930590J08Rik UTSW 6 91917035 missense probably benign 0.20
R1730:4930590J08Rik UTSW 6 91919278 missense possibly damaging 0.60
R1758:4930590J08Rik UTSW 6 91915222 missense possibly damaging 0.79
R1783:4930590J08Rik UTSW 6 91919278 missense possibly damaging 0.60
R1911:4930590J08Rik UTSW 6 91950069 splice site probably benign
R1930:4930590J08Rik UTSW 6 91915021 missense probably benign 0.01
R1936:4930590J08Rik UTSW 6 91917080 missense possibly damaging 0.90
R2157:4930590J08Rik UTSW 6 91917698 splice site probably null
R2157:4930590J08Rik UTSW 6 91942487 missense possibly damaging 0.48
R4072:4930590J08Rik UTSW 6 91945361 splice site probably null
R4662:4930590J08Rik UTSW 6 91914958 missense probably benign
R4900:4930590J08Rik UTSW 6 91918110 missense probably benign
R4936:4930590J08Rik UTSW 6 91944264 missense probably damaging 1.00
R5394:4930590J08Rik UTSW 6 91919193 missense probably benign 0.00
R5887:4930590J08Rik UTSW 6 91915143 nonsense probably null
R5931:4930590J08Rik UTSW 6 91919115 missense probably damaging 1.00
R6174:4930590J08Rik UTSW 6 91942536 missense probably damaging 0.99
R6179:4930590J08Rik UTSW 6 91942330 missense probably damaging 0.96
R6380:4930590J08Rik UTSW 6 91923137 missense probably damaging 1.00
R7570:4930590J08Rik UTSW 6 91934610 missense probably benign 0.03
R7860:4930590J08Rik UTSW 6 91928726 missense probably damaging 1.00
R7936:4930590J08Rik UTSW 6 91923464 nonsense probably null
R7958:4930590J08Rik UTSW 6 91934483 missense probably benign 0.02
R7968:4930590J08Rik UTSW 6 91945460 missense
R8111:4930590J08Rik UTSW 6 91917710 missense probably benign
R8953:4930590J08Rik UTSW 6 91915021 missense probably benign 0.01
R9084:4930590J08Rik UTSW 6 91915035 missense probably damaging 0.97
R9154:4930590J08Rik UTSW 6 91949945 missense probably benign 0.09
R9319:4930590J08Rik UTSW 6 91945465 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCTCCCTCGTAACAACTGGG -3'
(R):5'- CCATAGGGACACAGATTACCAAGG -3'

Sequencing Primer
(F):5'- AAGAAGAGTGTTCTGTTAGTCCCTC -3'
(R):5'- ACAGATTACCAAGGCATAAGGC -3'
Posted On 2018-06-06