Incidental Mutation 'R6531:4930590J08Rik'
ID522347
Institutional Source Beutler Lab
Gene Symbol 4930590J08Rik
Ensembl Gene ENSMUSG00000034063
Gene NameRIKEN cDNA 4930590J08 gene
SynonymsLOC381798
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6531 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location91902809-91950725 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 91949999 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 880 (E880G)
Ref Sequence ENSEMBL: ENSMUSP00000146101 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059318] [ENSMUST00000205686]
Predicted Effect possibly damaging
Transcript: ENSMUST00000059318
AA Change: E880G

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000053778
Gene: ENSMUSG00000034063
AA Change: E880G

DomainStartEndE-ValueType
low complexity region 89 109 N/A INTRINSIC
Pfam:FAM194 357 561 4.1e-68 PFAM
low complexity region 626 637 N/A INTRINSIC
transmembrane domain 774 796 N/A INTRINSIC
low complexity region 891 909 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205569
Predicted Effect possibly damaging
Transcript: ENSMUST00000205686
AA Change: E880G

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.2%
  • 20x: 90.6%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg2 T A 17: 56,846,617 I529F probably damaging Het
Ahcyl2 T G 6: 29,886,162 M359R probably benign Het
Aldh5a1 G T 13: 24,918,564 D305E probably benign Het
Catsper2 C G 2: 121,399,780 V358L possibly damaging Het
Cd200r4 C T 16: 44,833,505 Q222* probably null Het
Col4a2 T A 8: 11,408,135 D270E probably benign Het
Cux1 T C 5: 136,275,119 D1401G probably benign Het
Cyp3a59 T A 5: 146,098,217 M235K probably benign Het
Dock3 T C 9: 106,967,216 D895G probably benign Het
Dusp27 A T 1: 166,110,046 probably null Het
Dync1h1 T C 12: 110,617,920 F586L probably damaging Het
Elmo1 G T 13: 20,572,446 R568L possibly damaging Het
Epb41 T C 4: 131,957,636 T711A probably benign Het
Grm7 T A 6: 111,358,425 M599K probably benign Het
Hivep3 A T 4: 120,122,876 K1704* probably null Het
Ighv1-62-3 C A 12: 115,461,006 C115F probably damaging Het
Krt78 A G 15: 101,952,273 Y200H probably benign Het
Lamb2 A T 9: 108,483,726 H549L possibly damaging Het
Mroh3 A G 1: 136,184,353 I759T probably benign Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Nol6 G T 4: 41,118,154 P828T probably benign Het
Olfr1030 A G 2: 85,984,307 I156V probably benign Het
Olfr1132 A G 2: 87,635,529 Y73H probably damaging Het
Olfr1264 A G 2: 90,021,457 V203A probably benign Het
Olfr344 G A 2: 36,569,341 V248I probably damaging Het
Ovgp1 A C 3: 105,987,071 probably benign Het
Pitpnm3 T A 11: 72,071,487 Q230L possibly damaging Het
Pkn1 C T 8: 83,670,293 V910I probably benign Het
Plcb1 T A 2: 135,325,802 probably null Het
Ppp1r12c A G 7: 4,482,789 probably null Het
Rassf5 T A 1: 131,244,814 Q106L possibly damaging Het
Rfc1 T C 5: 65,312,979 K62E possibly damaging Het
Sf3b1 C T 1: 55,019,395 E12K probably damaging Het
Slc4a1ap A T 5: 31,548,638 D691V probably benign Het
Speg T A 1: 75,422,757 F2283I probably benign Het
Synj2 A G 17: 6,033,839 K267E probably damaging Het
Tg A T 15: 66,839,362 Y991F probably damaging Het
Tlk1 A T 2: 70,742,083 D380E probably benign Het
Trim43b A T 9: 89,085,365 L405H probably damaging Het
Ttf2 A G 3: 100,956,260 I586T probably damaging Het
Ugt2b36 T A 5: 87,081,586 R213S probably damaging Het
Vmn1r198 T A 13: 22,354,407 M21K probably benign Het
Wdr35 A T 12: 8,978,685 Y101F probably benign Het
Zfp367 T C 13: 64,144,250 Y189C probably damaging Het
Other mutations in 4930590J08Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:4930590J08Rik APN 6 91919118 missense possibly damaging 0.74
IGL01478:4930590J08Rik APN 6 91934609 missense probably benign 0.01
IGL01481:4930590J08Rik APN 6 91933098 missense probably damaging 1.00
IGL01485:4930590J08Rik APN 6 91950022 missense probably damaging 0.96
IGL01794:4930590J08Rik APN 6 91918112 nonsense probably null
IGL01795:4930590J08Rik APN 6 91918112 nonsense probably null
IGL02040:4930590J08Rik APN 6 91918110 missense probably benign
IGL02171:4930590J08Rik APN 6 91944256 missense probably benign 0.01
IGL02968:4930590J08Rik APN 6 91923473 missense probably damaging 1.00
IGL03358:4930590J08Rik APN 6 91928735 missense probably damaging 1.00
PIT4519001:4930590J08Rik UTSW 6 91917057 missense probably damaging 1.00
R0531:4930590J08Rik UTSW 6 91915146 missense probably benign
R0569:4930590J08Rik UTSW 6 91942578 nonsense probably null
R1536:4930590J08Rik UTSW 6 91917035 missense probably benign 0.20
R1730:4930590J08Rik UTSW 6 91919278 missense possibly damaging 0.60
R1758:4930590J08Rik UTSW 6 91915222 missense possibly damaging 0.79
R1783:4930590J08Rik UTSW 6 91919278 missense possibly damaging 0.60
R1911:4930590J08Rik UTSW 6 91950069 splice site probably benign
R1930:4930590J08Rik UTSW 6 91915021 missense probably benign 0.01
R1936:4930590J08Rik UTSW 6 91917080 missense possibly damaging 0.90
R2157:4930590J08Rik UTSW 6 91917698 splice site probably null
R2157:4930590J08Rik UTSW 6 91942487 missense possibly damaging 0.48
R4072:4930590J08Rik UTSW 6 91945361 splice site probably null
R4662:4930590J08Rik UTSW 6 91914958 missense probably benign
R4900:4930590J08Rik UTSW 6 91918110 missense probably benign
R4936:4930590J08Rik UTSW 6 91944264 missense probably damaging 1.00
R5394:4930590J08Rik UTSW 6 91919193 missense probably benign 0.00
R5887:4930590J08Rik UTSW 6 91915143 nonsense probably null
R5931:4930590J08Rik UTSW 6 91919115 missense probably damaging 1.00
R6174:4930590J08Rik UTSW 6 91942536 missense probably damaging 0.99
R6179:4930590J08Rik UTSW 6 91942330 missense probably damaging 0.96
R6380:4930590J08Rik UTSW 6 91923137 missense probably damaging 1.00
R7570:4930590J08Rik UTSW 6 91934610 missense probably benign 0.03
R7860:4930590J08Rik UTSW 6 91928726 missense probably damaging 1.00
R7936:4930590J08Rik UTSW 6 91923464 nonsense probably null
R7958:4930590J08Rik UTSW 6 91934483 missense probably benign 0.02
R7968:4930590J08Rik UTSW 6 91945460 missense
R8111:4930590J08Rik UTSW 6 91917710 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTCCCTCGTAACAACTGGG -3'
(R):5'- CCATAGGGACACAGATTACCAAGG -3'

Sequencing Primer
(F):5'- AAGAAGAGTGTTCTGTTAGTCCCTC -3'
(R):5'- ACAGATTACCAAGGCATAAGGC -3'
Posted On2018-06-06