Incidental Mutation 'R6717:Gm13119'
ID529422
Institutional Source Beutler Lab
Gene Symbol Gm13119
Ensembl Gene ENSMUSG00000070619
Gene Namepredicted gene 13119
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6717 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location144357942-144364419 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 144362657 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 182 (V182L)
Ref Sequence ENSEMBL: ENSMUSP00000092103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094526]
Predicted Effect probably benign
Transcript: ENSMUST00000094526
AA Change: V182L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000092103
Gene: ENSMUSG00000070619
AA Change: V182L

DomainStartEndE-ValueType
SCOP:d1a4ya_ 210 414 3e-10 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 C T 5: 4,064,086 L3122F probably damaging Het
Atp6v1b1 A T 6: 83,753,650 probably null Het
Ccdc178 A T 18: 22,020,889 V621E probably damaging Het
Cfap126 T C 1: 171,114,102 probably null Het
Cog2 T C 8: 124,525,749 I64T probably damaging Het
Dhx9 A C 1: 153,473,464 probably null Het
Efcab7 A G 4: 99,904,734 D407G possibly damaging Het
Eif2b5 G T 16: 20,505,283 G459C probably damaging Het
Eml5 T C 12: 98,827,506 E1168G probably damaging Het
Flnc AGCTGTCAAGTATGCTG AGCTG 6: 29,450,902 probably benign Het
Fry A G 5: 150,496,312 T980A probably benign Het
Gabbr2 A G 4: 46,787,574 V363A possibly damaging Het
Ggt6 T A 11: 72,437,520 L244* probably null Het
Gprc6a T A 10: 51,615,137 I768F probably damaging Het
Grk1 G A 8: 13,416,237 M560I probably benign Het
Hapln4 G A 8: 70,085,090 E145K probably damaging Het
Hoxd9 C T 2: 74,698,389 P112S probably benign Het
Ly6g6f T A 17: 35,085,574 M1L probably benign Het
Mast1 T C 8: 84,917,754 T849A probably benign Het
Mob4 A T 1: 55,136,713 M39L possibly damaging Het
Mrgpre A T 7: 143,781,523 L81Q probably damaging Het
Mst1 T C 9: 108,080,575 probably null Het
Muc5b A T 7: 141,857,822 R1502* probably null Het
Olfr1020 T A 2: 85,850,223 I257N probably damaging Het
Olfr142 T A 2: 90,252,524 I155L probably benign Het
Olfr311 T C 11: 58,841,287 Y58H probably damaging Het
Pdc A G 1: 150,333,018 D84G probably damaging Het
Peak1 T C 9: 56,207,239 N443D probably benign Het
Pkd1l3 T A 8: 109,614,769 W85R unknown Het
Rfc1 G A 5: 65,302,004 Q190* probably null Het
Rfc1 A G 5: 65,312,961 S68P probably damaging Het
Rnf145 T C 11: 44,561,490 V432A probably benign Het
Ror2 A G 13: 53,118,982 S204P probably damaging Het
Scn1a T C 2: 66,332,287 E205G probably damaging Het
Slc2a8 A C 2: 32,976,177 M277R probably damaging Het
Slc4a1 T C 11: 102,354,423 Y566C probably damaging Het
Slc6a12 A G 6: 121,354,303 N185S probably benign Het
Srcap GCTCCTCCTCCTCCTCCT GCTCCTCCTCCTCCT 7: 127,558,310 probably benign Het
Stk33 T A 7: 109,327,616 T279S possibly damaging Het
Taok3 A G 5: 117,240,950 probably benign Het
Tlr11 A G 14: 50,362,104 T516A probably benign Het
Tmem132c T A 5: 127,564,029 L1088Q possibly damaging Het
Tmem132d T A 5: 127,784,421 M879L probably benign Het
Tnk2 A G 16: 32,670,869 E322G probably damaging Het
Ttc28 T C 5: 111,285,436 V2081A probably benign Het
Ttn C T 2: 76,794,409 probably null Het
Zfp105 T C 9: 122,930,308 V348A possibly damaging Het
Zswim2 T C 2: 83,915,409 R562G probably benign Het
Other mutations in Gm13119
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Gm13119 APN 4 144362530 missense possibly damaging 0.91
IGL00485:Gm13119 APN 4 144363442 missense probably damaging 0.99
IGL01025:Gm13119 APN 4 144363377 missense probably damaging 1.00
IGL01102:Gm13119 APN 4 144363625 missense probably benign 0.08
IGL01631:Gm13119 APN 4 144362445 missense probably benign 0.12
IGL02228:Gm13119 APN 4 144362661 missense probably damaging 1.00
IGL02708:Gm13119 APN 4 144363413 missense probably damaging 1.00
IGL02827:Gm13119 APN 4 144363761 missense probably damaging 1.00
IGL03398:Gm13119 APN 4 144363491 missense probably damaging 1.00
R0403:Gm13119 UTSW 4 144362646 missense probably benign 0.00
R0627:Gm13119 UTSW 4 144362846 missense probably benign 0.03
R0632:Gm13119 UTSW 4 144363782 missense probably damaging 1.00
R1783:Gm13119 UTSW 4 144361725 missense probably benign 0.01
R1895:Gm13119 UTSW 4 144361865 missense probably benign 0.11
R1946:Gm13119 UTSW 4 144361865 missense probably benign 0.11
R2263:Gm13119 UTSW 4 144363541 missense probably benign 0.00
R2389:Gm13119 UTSW 4 144363413 missense probably damaging 1.00
R2435:Gm13119 UTSW 4 144362903 missense possibly damaging 0.75
R3013:Gm13119 UTSW 4 144362455 missense probably damaging 0.98
R3021:Gm13119 UTSW 4 144361799 missense probably damaging 0.99
R3106:Gm13119 UTSW 4 144361676 missense probably benign 0.04
R5237:Gm13119 UTSW 4 144362471 nonsense probably null
R5411:Gm13119 UTSW 4 144361637 start codon destroyed probably null 1.00
R5532:Gm13119 UTSW 4 144363491 missense probably damaging 1.00
R6229:Gm13119 UTSW 4 144363629 missense probably benign 0.03
R6277:Gm13119 UTSW 4 144363653 missense probably damaging 1.00
R6625:Gm13119 UTSW 4 144363799 missense probably damaging 1.00
R7103:Gm13119 UTSW 4 144363727 missense probably benign 0.00
R7207:Gm13119 UTSW 4 144361903 missense probably benign 0.08
Z1177:Gm13119 UTSW 4 144362973 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TGTTTCAGCTGGACCAGAGG -3'
(R):5'- AAAAGTGAAGAGTTTCTCGTGGAC -3'

Sequencing Primer
(F):5'- TTTCAGCTGGACCAGAGGATGAAG -3'
(R):5'- ACTAGTGTTAGATGGAGTTTACGAAG -3'
Posted On2018-08-01