Incidental Mutation 'R6717:Tlr11'
ID529451
Institutional Source Beutler Lab
Gene Symbol Tlr11
Ensembl Gene ENSMUSG00000051969
Gene Nametoll-like receptor 11
SynonymsLOC239081
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6717 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location50357914-50363663 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 50362104 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 516 (T516A)
Ref Sequence ENSEMBL: ENSMUSP00000138814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063570] [ENSMUST00000185091]
Predicted Effect probably benign
Transcript: ENSMUST00000063570
AA Change: T511A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000068906
Gene: ENSMUSG00000051969
AA Change: T511A

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
low complexity region 105 122 N/A INTRINSIC
low complexity region 153 161 N/A INTRINSIC
LRR 311 333 3.36e1 SMART
LRR 335 361 4.44e0 SMART
LRR 362 383 2.03e1 SMART
LRR_TYP 384 407 2.57e-3 SMART
LRR_TYP 408 431 2.75e-3 SMART
low complexity region 544 556 N/A INTRINSIC
LRR 605 628 6.06e1 SMART
transmembrane domain 719 741 N/A INTRINSIC
Pfam:TIR 773 922 2.1e-9 PFAM
Pfam:TIR_2 776 894 6.6e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185091
AA Change: T516A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138814
Gene: ENSMUSG00000051969
AA Change: T516A

DomainStartEndE-ValueType
transmembrane domain 16 38 N/A INTRINSIC
low complexity region 110 127 N/A INTRINSIC
low complexity region 158 166 N/A INTRINSIC
Pfam:LRR_6 221 244 5.3e-2 PFAM
LRR 316 338 3.36e1 SMART
LRR 340 366 4.44e0 SMART
LRR 367 388 2.03e1 SMART
LRR_TYP 389 412 2.57e-3 SMART
LRR_TYP 413 436 2.75e-3 SMART
low complexity region 549 561 N/A INTRINSIC
LRR 610 633 6.06e1 SMART
transmembrane domain 724 746 N/A INTRINSIC
Pfam:TIR_2 781 898 1e-12 PFAM
Pfam:TIR 781 922 1.8e-13 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 C T 5: 4,064,086 L3122F probably damaging Het
Atp6v1b1 A T 6: 83,753,650 probably null Het
Ccdc178 A T 18: 22,020,889 V621E probably damaging Het
Cfap126 T C 1: 171,114,102 probably null Het
Cog2 T C 8: 124,525,749 I64T probably damaging Het
Dhx9 A C 1: 153,473,464 probably null Het
Efcab7 A G 4: 99,904,734 D407G possibly damaging Het
Eif2b5 G T 16: 20,505,283 G459C probably damaging Het
Eml5 T C 12: 98,827,506 E1168G probably damaging Het
Flnc AGCTGTCAAGTATGCTG AGCTG 6: 29,450,902 probably benign Het
Fry A G 5: 150,496,312 T980A probably benign Het
Gabbr2 A G 4: 46,787,574 V363A possibly damaging Het
Ggt6 T A 11: 72,437,520 L244* probably null Het
Gm13119 G T 4: 144,362,657 V182L probably benign Het
Gprc6a T A 10: 51,615,137 I768F probably damaging Het
Grk1 G A 8: 13,416,237 M560I probably benign Het
Hapln4 G A 8: 70,085,090 E145K probably damaging Het
Hoxd9 C T 2: 74,698,389 P112S probably benign Het
Ly6g6f T A 17: 35,085,574 M1L probably benign Het
Mast1 T C 8: 84,917,754 T849A probably benign Het
Mob4 A T 1: 55,136,713 M39L possibly damaging Het
Mrgpre A T 7: 143,781,523 L81Q probably damaging Het
Mst1 T C 9: 108,080,575 probably null Het
Muc5b A T 7: 141,857,822 R1502* probably null Het
Olfr1020 T A 2: 85,850,223 I257N probably damaging Het
Olfr142 T A 2: 90,252,524 I155L probably benign Het
Olfr311 T C 11: 58,841,287 Y58H probably damaging Het
Pdc A G 1: 150,333,018 D84G probably damaging Het
Peak1 T C 9: 56,207,239 N443D probably benign Het
Pkd1l3 T A 8: 109,614,769 W85R unknown Het
Rfc1 G A 5: 65,302,004 Q190* probably null Het
Rfc1 A G 5: 65,312,961 S68P probably damaging Het
Rnf145 T C 11: 44,561,490 V432A probably benign Het
Ror2 A G 13: 53,118,982 S204P probably damaging Het
Scn1a T C 2: 66,332,287 E205G probably damaging Het
Slc2a8 A C 2: 32,976,177 M277R probably damaging Het
Slc4a1 T C 11: 102,354,423 Y566C probably damaging Het
Slc6a12 A G 6: 121,354,303 N185S probably benign Het
Srcap GCTCCTCCTCCTCCTCCT GCTCCTCCTCCTCCT 7: 127,558,310 probably benign Het
Stk33 T A 7: 109,327,616 T279S possibly damaging Het
Taok3 A G 5: 117,240,950 probably benign Het
Tmem132c T A 5: 127,564,029 L1088Q possibly damaging Het
Tmem132d T A 5: 127,784,421 M879L probably benign Het
Tnk2 A G 16: 32,670,869 E322G probably damaging Het
Ttc28 T C 5: 111,285,436 V2081A probably benign Het
Ttn C T 2: 76,794,409 probably null Het
Zfp105 T C 9: 122,930,308 V348A possibly damaging Het
Zswim2 T C 2: 83,915,409 R562G probably benign Het
Other mutations in Tlr11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00590:Tlr11 APN 14 50360916 missense probably benign
IGL02090:Tlr11 APN 14 50363032 missense probably damaging 0.99
IGL02286:Tlr11 APN 14 50360871 missense possibly damaging 0.91
IGL02671:Tlr11 APN 14 50360692 missense probably damaging 1.00
IGL03064:Tlr11 APN 14 50361100 missense probably damaging 1.00
IGL03068:Tlr11 APN 14 50361484 missense probably benign
R0099:Tlr11 UTSW 14 50360818 missense probably benign 0.14
R0727:Tlr11 UTSW 14 50361469 missense possibly damaging 0.67
R0944:Tlr11 UTSW 14 50362336 missense probably benign 0.12
R1490:Tlr11 UTSW 14 50363176 missense probably benign 0.00
R1726:Tlr11 UTSW 14 50361541 missense probably benign 0.00
R1803:Tlr11 UTSW 14 50360647 missense probably benign 0.00
R1908:Tlr11 UTSW 14 50361207 missense probably benign 0.00
R1971:Tlr11 UTSW 14 50361234 missense probably benign
R1981:Tlr11 UTSW 14 50361988 missense possibly damaging 0.95
R2023:Tlr11 UTSW 14 50362569 missense probably damaging 0.96
R2079:Tlr11 UTSW 14 50360980 missense probably damaging 0.99
R2155:Tlr11 UTSW 14 50360682 missense probably benign 0.01
R2251:Tlr11 UTSW 14 50360792 missense probably benign 0.02
R3017:Tlr11 UTSW 14 50362721 nonsense probably null
R3760:Tlr11 UTSW 14 50362243 missense probably damaging 1.00
R3876:Tlr11 UTSW 14 50363154 missense probably benign
R3936:Tlr11 UTSW 14 50362735 missense possibly damaging 0.78
R4002:Tlr11 UTSW 14 50362527 missense probably benign
R4024:Tlr11 UTSW 14 50362846 missense probably benign 0.02
R4118:Tlr11 UTSW 14 50363227 missense probably damaging 1.00
R4222:Tlr11 UTSW 14 50361849 missense probably damaging 0.99
R4365:Tlr11 UTSW 14 50361469 missense probably damaging 0.98
R4678:Tlr11 UTSW 14 50360982 missense possibly damaging 0.85
R4779:Tlr11 UTSW 14 50361250 missense possibly damaging 0.76
R4910:Tlr11 UTSW 14 50362889 missense probably benign 0.45
R4921:Tlr11 UTSW 14 50362885 missense possibly damaging 0.48
R5114:Tlr11 UTSW 14 50363121 missense possibly damaging 0.81
R5126:Tlr11 UTSW 14 50360830 missense probably damaging 1.00
R5349:Tlr11 UTSW 14 50360880 missense probably benign 0.45
R5606:Tlr11 UTSW 14 50362260 missense probably benign 0.08
R5650:Tlr11 UTSW 14 50361201 missense probably benign 0.03
R5958:Tlr11 UTSW 14 50360777 missense probably damaging 0.99
R5966:Tlr11 UTSW 14 50362255 missense probably benign 0.02
R6480:Tlr11 UTSW 14 50363055 missense possibly damaging 0.62
R6484:Tlr11 UTSW 14 50362678 missense probably damaging 0.99
R6679:Tlr11 UTSW 14 50362854 missense probably benign 0.00
R7085:Tlr11 UTSW 14 50362656 missense probably damaging 0.99
R7241:Tlr11 UTSW 14 50362141 missense possibly damaging 0.95
R7440:Tlr11 UTSW 14 50361344 missense probably benign 0.00
R7482:Tlr11 UTSW 14 50362999 missense probably damaging 0.99
R7582:Tlr11 UTSW 14 50361729 nonsense probably null
R7790:Tlr11 UTSW 14 50361925 missense probably benign
R7818:Tlr11 UTSW 14 50361828 missense probably damaging 1.00
R7827:Tlr11 UTSW 14 50361154 missense probably benign 0.00
R8144:Tlr11 UTSW 14 50362488 missense probably damaging 0.99
R8847:Tlr11 UTSW 14 50362725 missense possibly damaging 0.85
RF002:Tlr11 UTSW 14 50361225 missense possibly damaging 0.63
Z1088:Tlr11 UTSW 14 50362338 missense possibly damaging 0.48
Z1176:Tlr11 UTSW 14 50360662 missense probably damaging 1.00
Z1176:Tlr11 UTSW 14 50362336 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- GACTACCTTGAACCTTCTGGGC -3'
(R):5'- CTGCATAGCTGTTTTCACACCAG -3'

Sequencing Primer
(F):5'- TTAGGCATACAACTTCAGGGTCC -3'
(R):5'- TTTCACACCAGATAAAGAAGTGCTC -3'
Posted On2018-08-01