Incidental Mutation 'R6848:Cep70'
ID534869
Institutional Source Beutler Lab
Gene Symbol Cep70
Ensembl Gene ENSMUSG00000056267
Gene Namecentrosomal protein 70
SynonymsC030018L16Rik, 6720484E09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.242) question?
Stock #R6848 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location99243367-99300404 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 99262901 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 100 (R100H)
Ref Sequence ENSEMBL: ENSMUSP00000140377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093795] [ENSMUST00000185799] [ENSMUST00000190078] [ENSMUST00000190715] [ENSMUST00000191014] [ENSMUST00000191335]
Predicted Effect probably benign
Transcript: ENSMUST00000093795
AA Change: R100H

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000091312
Gene: ENSMUSG00000056267
AA Change: R100H

DomainStartEndE-ValueType
coiled coil region 96 210 N/A INTRINSIC
coiled coil region 278 299 N/A INTRINSIC
low complexity region 319 335 N/A INTRINSIC
low complexity region 528 544 N/A INTRINSIC
low complexity region 591 602 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185799
AA Change: R100H

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000139458
Gene: ENSMUSG00000056267
AA Change: R100H

DomainStartEndE-ValueType
coiled coil region 96 156 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190078
Predicted Effect probably benign
Transcript: ENSMUST00000190715
AA Change: R100H

PolyPhen 2 Score 0.344 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000140377
Gene: ENSMUSG00000056267
AA Change: R100H

DomainStartEndE-ValueType
coiled coil region 96 157 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191014
AA Change: R100H

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000191335
AA Change: R100H

PolyPhen 2 Score 0.155 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000139816
Gene: ENSMUSG00000056267
AA Change: R100H

DomainStartEndE-ValueType
coiled coil region 96 210 N/A INTRINSIC
coiled coil region 278 299 N/A INTRINSIC
low complexity region 319 335 N/A INTRINSIC
low complexity region 528 544 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap1 T C 11: 69,884,661 N290S probably damaging Het
Acox3 G T 5: 35,592,184 G218C probably damaging Het
Acsf3 G A 8: 122,790,590 G375D probably damaging Het
Adamts9 G T 6: 92,863,354 N568K possibly damaging Het
Akr1cl G A 1: 65,024,769 T87I probably damaging Het
Cacna1s G A 1: 136,092,694 R823Q probably benign Het
Casp16-ps A T 17: 23,551,079 C175* probably null Het
Cast T C 13: 74,695,933 K694R possibly damaging Het
Cep72 C T 13: 74,038,276 A259T possibly damaging Het
Chsy1 T A 7: 66,171,037 M340K probably damaging Het
Col27a1 T C 4: 63,302,371 S182P probably benign Het
Crlf2 A C 5: 109,557,031 F103V possibly damaging Het
Dync2h1 T C 9: 7,159,632 N652S probably benign Het
Ephx4 G A 5: 107,426,918 G274D probably damaging Het
Fer T A 17: 63,991,606 F517I probably damaging Het
Fsip2 A T 2: 82,982,787 H3150L probably benign Het
Gata3 T A 2: 9,858,528 N392Y possibly damaging Het
Gm17660 A G 5: 104,074,737 probably benign Het
Gm5136 A T 10: 108,699,590 V168E probably damaging Het
Gria4 C T 9: 4,793,822 V79M probably damaging Het
Grk3 A C 5: 112,985,775 N60K probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Igf1r T G 7: 68,004,179 I155R probably damaging Het
Igsf9 T C 1: 172,495,762 L681P probably damaging Het
Intu T C 3: 40,694,255 M789T probably benign Het
Kit A T 5: 75,607,212 Q85L probably benign Het
Klhdc2 T A 12: 69,308,976 C325* probably null Het
Mcidas A G 13: 112,993,885 E5G probably benign Het
Mcm5 G T 8: 75,127,290 R724L possibly damaging Het
Nrbp2 G A 15: 76,091,483 probably benign Het
Nrg1 A G 8: 31,818,056 I655T probably damaging Het
Nsun4 T C 4: 116,052,934 D143G possibly damaging Het
Olfr214 T C 6: 116,556,775 S117P probably damaging Het
Olfr610 A G 7: 103,506,457 V163A possibly damaging Het
Olfr74 A T 2: 87,974,170 V165E possibly damaging Het
Opn3 C T 1: 175,663,049 V349M probably damaging Het
Pank2 C A 2: 131,282,626 L297I probably damaging Het
Pcdh20 T A 14: 88,467,254 E870V probably benign Het
Pdcd6 T A 13: 74,309,840 M71L possibly damaging Het
Phkb A T 8: 86,029,617 I847F probably damaging Het
Psmb1 A G 17: 15,477,247 F202S probably benign Het
Pwp2 C G 10: 78,184,293 probably null Het
Rbms3 A G 9: 117,251,741 Y21H probably damaging Het
Rhbdl1 T A 17: 25,836,184 K17* probably null Het
Rp1l1 C A 14: 64,028,218 Q418K possibly damaging Het
Slc22a4 A T 11: 54,007,789 V159E possibly damaging Het
Spata31d1a T C 13: 59,701,963 T784A possibly damaging Het
Tll1 A G 8: 64,098,510 M279T probably damaging Het
Tmem163 A T 1: 127,551,380 V134D probably damaging Het
Top2b A G 14: 16,409,958 N875S possibly damaging Het
Tpd52l1 T C 10: 31,332,857 E205G probably benign Het
Tpsb2 T A 17: 25,367,828 Y271* probably null Het
Ugt3a1 G A 15: 9,280,052 probably null Het
Vmn2r67 T C 7: 85,152,632 M154V probably benign Het
Zfp740 T G 15: 102,208,808 I89S probably benign Het
Other mutations in Cep70
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01445:Cep70 APN 9 99298500 unclassified probably benign
IGL02719:Cep70 APN 9 99275722 missense probably damaging 0.99
IGL02878:Cep70 APN 9 99281107 splice site probably benign
IGL02969:Cep70 APN 9 99298504 missense possibly damaging 0.88
R0426:Cep70 UTSW 9 99297684 missense probably benign 0.02
R0970:Cep70 UTSW 9 99275599 missense possibly damaging 0.93
R1238:Cep70 UTSW 9 99254265 missense probably benign 0.05
R1462:Cep70 UTSW 9 99263720 missense probably benign 0.20
R1462:Cep70 UTSW 9 99263720 missense probably benign 0.20
R2141:Cep70 UTSW 9 99296385 missense probably damaging 1.00
R3922:Cep70 UTSW 9 99275579 makesense probably null
R3964:Cep70 UTSW 9 99298534 missense probably damaging 1.00
R3965:Cep70 UTSW 9 99298534 missense probably damaging 1.00
R4044:Cep70 UTSW 9 99262609 missense possibly damaging 0.66
R4174:Cep70 UTSW 9 99246313 start gained probably benign
R4659:Cep70 UTSW 9 99296341 missense possibly damaging 0.86
R4672:Cep70 UTSW 9 99254312 missense possibly damaging 0.66
R4839:Cep70 UTSW 9 99296085 missense probably benign 0.16
R5108:Cep70 UTSW 9 99263812 splice site probably null
R5288:Cep70 UTSW 9 99281075 missense probably damaging 1.00
R5386:Cep70 UTSW 9 99281075 missense probably damaging 1.00
R5802:Cep70 UTSW 9 99296405 missense probably damaging 0.96
R5934:Cep70 UTSW 9 99254265 missense probably benign 0.05
R6076:Cep70 UTSW 9 99298505 missense probably damaging 1.00
R6977:Cep70 UTSW 9 99291676 missense probably damaging 1.00
R7286:Cep70 UTSW 9 99275585 missense probably damaging 1.00
R7437:Cep70 UTSW 9 99291529 missense probably damaging 1.00
R7754:Cep70 UTSW 9 99281092 missense probably damaging 1.00
R7879:Cep70 UTSW 9 99262633 missense possibly damaging 0.54
R7962:Cep70 UTSW 9 99262633 missense possibly damaging 0.54
R8063:Cep70 UTSW 9 99296122 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GGAGCAGATCTCAGAGGTAACTAC -3'
(R):5'- GGTGCCATTACACGTCAATGC -3'

Sequencing Primer
(F):5'- GGTAACTACATCCTGCTGATTTG -3'
(R):5'- AGTTCCCAGCATGCATAGTG -3'
Posted On2018-09-12