Mutagenetix > Incidental Mutation

Incidental Mutation 'R6848:Kit'

534851

Institutional Source

Beutler Lab

Gene Symbol

Kit

Ensembl Gene

ENSMUSG00000005672

Gene Name

KIT proto-oncogene receptor tyrosine kinase

Synonyms

SCO5, Dominant white spotting, Tr-kit, belly-spot, CD117, Gsfsow3, Gsfsco5, SOW3, SCO1, Steel Factor Receptor, c-KIT, Gsfsco1

MMRRC Submission

045022-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.939) question?

Stock #

R6848 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

75574916-75656722 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 75607212 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 85 (Q85L)

Ref Sequence

ENSEMBL: ENSMUSP00000116465 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005815] [ENSMUST00000144270]

AlphaFold

P05532

Predicted Effect

probably benign
Transcript: ENSMUST00000005815
AA Change: Q85L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000005815
Gene: ENSMUSG00000005672
AA Change: Q85L

Domain	Start	End	E-Value	Type
low complexity region	10	18	N/A	INTRINSIC
low complexity region	25	38	N/A	INTRINSIC
IG	43	113	3.02e0	SMART
IG_like	122	206	1.09e2	SMART
IGc2	225	300	3.79e-4	SMART
IG	323	413	1.21e-2	SMART
IG_like	429	501	1.88e0	SMART
transmembrane domain	524	546	N/A	INTRINSIC
TyrKc	592	926	2.5e-138	SMART
low complexity region	945	963	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000144270
AA Change: Q85L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000116465
Gene: ENSMUSG00000005672
AA Change: Q85L

Domain	Start	End	E-Value	Type
low complexity region	1	10	N/A	INTRINSIC
low complexity region	22	30	N/A	INTRINSIC
low complexity region	37	50	N/A	INTRINSIC
IG	55	125	3.02e0	SMART
IG_like	134	218	1.09e2	SMART
IGc2	237	312	3.79e-4	SMART
IG	335	425	1.21e-2	SMART
IG_like	441	513	1.88e0	SMART
transmembrane domain	532	554	N/A	INTRINSIC
TyrKc	600	934	2.5e-138	SMART
low complexity region	953	971	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.2%

Validation Efficiency

98% (54/55)

MGI Phenotype

FUNCTION: The c-Kit proto-oncogene is the cellular homolog of the transforming gene of a feline retrovirus (v-Kit). The c-kit protein includes characteristics of a protein kinase transmembrane receptor. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations at this locus affect migration of embryonic stem cell populations, resulting in mild to severe impairments in hematopoiesis, and pigmentation. Some alleles are homozygous lethal, sterile, or result in the formation of gastrointestinal tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acap1	T	C	11: 69,884,661	N290S	probably damaging	Het
Acox3	G	T	5: 35,592,184	G218C	probably damaging	Het
Acsf3	G	A	8: 122,790,590	G375D	probably damaging	Het
Adamts9	G	T	6: 92,863,354	N568K	possibly damaging	Het
Akr1cl	G	A	1: 65,024,769	T87I	probably damaging	Het
Cacna1s	G	A	1: 136,092,694	R823Q	probably benign	Het
Casp16-ps	A	T	17: 23,551,079	C175*	probably null	Het
Cast	T	C	13: 74,695,933	K694R	possibly damaging	Het
Cep70	G	A	9: 99,262,901	R100H	probably benign	Het
Cep72	C	T	13: 74,038,276	A259T	possibly damaging	Het
Chsy1	T	A	7: 66,171,037	M340K	probably damaging	Het
Col27a1	T	C	4: 63,302,371	S182P	probably benign	Het
Crlf2	A	C	5: 109,557,031	F103V	possibly damaging	Het
Dync2h1	T	C	9: 7,159,632	N652S	probably benign	Het
Ephx4	G	A	5: 107,426,918	G274D	probably damaging	Het
Fer	T	A	17: 63,991,606	F517I	probably damaging	Het
Fsip2	A	T	2: 82,982,787	H3150L	probably benign	Het
Gata3	T	A	2: 9,858,528	N392Y	possibly damaging	Het
Gm17660	A	G	5: 104,074,737		probably benign	Het
Gm5136	A	T	10: 108,699,590	V168E	probably damaging	Het
Gria4	C	T	9: 4,793,822	V79M	probably damaging	Het
Grk3	A	C	5: 112,985,775	N60K	probably damaging	Het
Idh2	TCCCAGG	T	7: 80,098,331		probably benign	Het
Igf1r	T	G	7: 68,004,179	I155R	probably damaging	Het
Igsf9	T	C	1: 172,495,762	L681P	probably damaging	Het
Intu	T	C	3: 40,694,255	M789T	probably benign	Het
Klhdc2	T	A	12: 69,308,976	C325*	probably null	Het
Mcidas	A	G	13: 112,993,885	E5G	probably benign	Het
Mcm5	G	T	8: 75,127,290	R724L	possibly damaging	Het
Nrbp2	G	A	15: 76,091,483		probably benign	Het
Nrg1	A	G	8: 31,818,056	I655T	probably damaging	Het
Nsun4	T	C	4: 116,052,934	D143G	possibly damaging	Het
Olfr214	T	C	6: 116,556,775	S117P	probably damaging	Het
Olfr610	A	G	7: 103,506,457	V163A	possibly damaging	Het
Olfr74	A	T	2: 87,974,170	V165E	possibly damaging	Het
Opn3	C	T	1: 175,663,049	V349M	probably damaging	Het
Pank2	C	A	2: 131,282,626	L297I	probably damaging	Het
Pcdh20	T	A	14: 88,467,254	E870V	probably benign	Het
Pdcd6	T	A	13: 74,309,840	M71L	possibly damaging	Het
Phkb	A	T	8: 86,029,617	I847F	probably damaging	Het
Psmb1	A	G	17: 15,477,247	F202S	probably benign	Het
Pwp2	C	G	10: 78,184,293		probably null	Het
Rbms3	A	G	9: 117,251,741	Y21H	probably damaging	Het
Rhbdl1	T	A	17: 25,836,184	K17*	probably null	Het
Rp1l1	C	A	14: 64,028,218	Q418K	possibly damaging	Het
Slc22a4	A	T	11: 54,007,789	V159E	possibly damaging	Het
Spata31d1a	T	C	13: 59,701,963	T784A	possibly damaging	Het
Tll1	A	G	8: 64,098,510	M279T	probably damaging	Het
Tmem163	A	T	1: 127,551,380	V134D	probably damaging	Het
Top2b	A	G	14: 16,409,958	N875S	possibly damaging	Het
Tpd52l1	T	C	10: 31,332,857	E205G	probably benign	Het
Tpsb2	T	A	17: 25,367,828	Y271*	probably null	Het
Ugt3a1	G	A	15: 9,280,052		probably null	Het
Vmn2r67	T	C	7: 85,152,632	M154V	probably benign	Het
Zfp740	T	G	15: 102,208,808	I89S	probably benign	Het

Other mutations in Kit

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00466:Kit	APN	5	75610819	missense	probably benign	0.00
IGL00834:Kit	APN	5	75645959	missense	probably damaging	1.00
IGL00846:Kit	APN	5	75640811	missense	probably damaging	0.98
IGL01149:Kit	APN	5	75610876	missense	probably damaging	0.97
IGL01341:Kit	APN	5	75607074	missense	probably damaging	1.00
IGL02004:Kit	APN	5	75621014	missense	probably benign
IGL02281:Kit	APN	5	75654534	missense	possibly damaging	0.66
IGL02424:Kit	APN	5	75639106	missense	probably benign
IGL02697:Kit	APN	5	75607259	missense	probably benign
IGL02929:Kit	APN	5	75640769	missense	probably damaging	1.00
IGL03053:Kit	APN	5	75610914	missense	probably benign
IGL03127:Kit	APN	5	75641188	missense	probably benign	0.44
IGL03174:Kit	APN	5	75607113	missense	probably benign
IGL03381:Kit	APN	5	75607128	missense	probably benign	0.04
casper	UTSW	5	75645875	missense	probably damaging	1.00
Mooyah2	UTSW	5	75652808	missense	probably damaging	1.00
pretty2	UTSW	5	75649550	missense	probably damaging	1.00
slimmer	UTSW	5	75640757	missense	possibly damaging	0.94
IGL02837:Kit	UTSW	5	75639008	missense	probably benign	0.00
R0022:Kit	UTSW	5	75622997	missense	probably benign	0.00
R0022:Kit	UTSW	5	75622997	missense	probably benign	0.00
R0092:Kit	UTSW	5	75647754	missense	possibly damaging	0.93
R0254:Kit	UTSW	5	75620921	missense	probably benign
R0329:Kit	UTSW	5	75652829	missense	probably damaging	1.00
R0609:Kit	UTSW	5	75610879	missense	probably benign	0.35
R1068:Kit	UTSW	5	75609518	missense	probably benign
R1115:Kit	UTSW	5	75649532	splice site	probably benign
R1480:Kit	UTSW	5	75637317	missense	probably benign	0.00
R1639:Kit	UTSW	5	75652807	missense	probably damaging	1.00
R1801:Kit	UTSW	5	75648393	missense	probably damaging	1.00
R1973:Kit	UTSW	5	75615442	missense	probably damaging	1.00
R2033:Kit	UTSW	5	75637317	missense	possibly damaging	0.88
R3125:Kit	UTSW	5	75647827	missense	probably benign	0.07
R3125:Kit	UTSW	5	75647828	missense	probably null	0.00
R3437:Kit	UTSW	5	75645905	missense	probably damaging	1.00
R3791:Kit	UTSW	5	75639150	missense	probably damaging	1.00
R3939:Kit	UTSW	5	75609318	missense	probably benign	0.00
R3940:Kit	UTSW	5	75609318	missense	probably benign	0.00
R3941:Kit	UTSW	5	75609318	missense	probably benign	0.00
R3942:Kit	UTSW	5	75609318	missense	probably benign	0.00
R4092:Kit	UTSW	5	75610810	missense	probably benign	0.28
R4376:Kit	UTSW	5	75640499	missense	probably benign	0.00
R4377:Kit	UTSW	5	75640499	missense	probably benign	0.00
R4668:Kit	UTSW	5	75641220	splice site	probably null
R5104:Kit	UTSW	5	75615478	missense	probably benign	0.00
R5152:Kit	UTSW	5	75620847	missense	probably benign	0.00
R5154:Kit	UTSW	5	75640540	missense	probably damaging	0.99
R5508:Kit	UTSW	5	75649548	missense	probably damaging	1.00
R5624:Kit	UTSW	5	75609394	missense	probably benign	0.40
R5731:Kit	UTSW	5	75654415	missense	possibly damaging	0.93
R6270:Kit	UTSW	5	75609509	missense	probably benign
R6565:Kit	UTSW	5	75645853	missense	probably damaging	1.00
R6694:Kit	UTSW	5	75640757	missense	possibly damaging	0.94
R6805:Kit	UTSW	5	75652808	missense	probably damaging	1.00
R6823:Kit	UTSW	5	75652649	missense	probably benign	0.01
R7021:Kit	UTSW	5	75620967	missense	probably benign	0.00
R7080:Kit	UTSW	5	75607281	missense	probably damaging	0.99
R7117:Kit	UTSW	5	75607098	missense	probably benign	0.18
R7156:Kit	UTSW	5	75615374	missense	probably benign	0.14
R7379:Kit	UTSW	5	75647752	missense	probably damaging	1.00
R7427:Kit	UTSW	5	75645847	missense	possibly damaging	0.92
R7438:Kit	UTSW	5	75639000	missense	probably benign	0.01
R7531:Kit	UTSW	5	75607040	missense	probably damaging	0.99
R7711:Kit	UTSW	5	75637359	missense	probably damaging	0.97
R7810:Kit	UTSW	5	75609322	missense	probably benign	0.11
R7819:Kit	UTSW	5	75645932	missense	probably benign	0.41
R8021:Kit	UTSW	5	75615491	missense	possibly damaging	0.79
R8139:Kit	UTSW	5	75652805	missense	probably damaging	0.99
R8165:Kit	UTSW	5	75620880	missense	possibly damaging	0.94
R8249:Kit	UTSW	5	75641408	missense	probably damaging	0.97
R8288:Kit	UTSW	5	75654489	missense	probably damaging	1.00
R8290:Kit	UTSW	5	75641169	missense	probably benign
R8829:Kit	UTSW	5	75639131	missense	probably benign	0.41
R8832:Kit	UTSW	5	75639131	missense	probably benign	0.41
R8969:Kit	UTSW	5	75639062	missense
R9081:Kit	UTSW	5	75640558	missense	probably benign
R9146:Kit	UTSW	5	75649645	missense	probably damaging	1.00
R9232:Kit	UTSW	5	75639132	missense	probably benign	0.00
R9631:Kit	UTSW	5	75607029	missense	possibly damaging	0.95
U24488:Kit	UTSW	5	75623014	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TTACTTCGCCAAGACAGCTC -3'
(R):5'- CCAAATCCTGCCTGTGGTTTG -3'

Sequencing Primer
(F):5'- CGTCTCAGCCATCTGCAAG -3'
(R):5'- GCCTGTGGTTTGGTCACCTC -3'

Posted On

2018-09-12