Incidental Mutation 'R6848:Acap1'
ID534875
Institutional Source Beutler Lab
Gene Symbol Acap1
Ensembl Gene ENSMUSG00000001588
Gene NameArfGAP with coiled-coil, ankyrin repeat and PH domains 1
SynonymsCentb1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6848 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location69881567-69895539 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 69884661 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 290 (N290S)
Ref Sequence ENSEMBL: ENSMUSP00000104262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001631] [ENSMUST00000050555] [ENSMUST00000108622]
Predicted Effect probably damaging
Transcript: ENSMUST00000001631
AA Change: N478S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001631
Gene: ENSMUSG00000001588
AA Change: N478S

DomainStartEndE-ValueType
Pfam:BAR_3 5 240 2.1e-68 PFAM
PH 266 362 4.42e-15 SMART
ArfGap 405 527 2.42e-50 SMART
ANK 606 635 4.01e0 SMART
ANK 639 668 3.04e0 SMART
ANK 672 702 4.18e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000050555
SMART Domains Protein: ENSMUSP00000059107
Gene: ENSMUSG00000046731

DomainStartEndE-ValueType
Pfam:BTB_2 1 73 1.8e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108622
AA Change: N290S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104262
Gene: ENSMUSG00000001588
AA Change: N290S

DomainStartEndE-ValueType
PH 78 174 4.42e-15 SMART
ArfGap 217 339 2.42e-50 SMART
ANK 418 447 4.01e0 SMART
ANK 451 480 3.04e0 SMART
ANK 484 514 4.18e2 SMART
Meta Mutation Damage Score 0.9325 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox3 G T 5: 35,592,184 G218C probably damaging Het
Acsf3 G A 8: 122,790,590 G375D probably damaging Het
Adamts9 G T 6: 92,863,354 N568K possibly damaging Het
Akr1cl G A 1: 65,024,769 T87I probably damaging Het
Cacna1s G A 1: 136,092,694 R823Q probably benign Het
Casp16-ps A T 17: 23,551,079 C175* probably null Het
Cast T C 13: 74,695,933 K694R possibly damaging Het
Cep70 G A 9: 99,262,901 R100H probably benign Het
Cep72 C T 13: 74,038,276 A259T possibly damaging Het
Chsy1 T A 7: 66,171,037 M340K probably damaging Het
Col27a1 T C 4: 63,302,371 S182P probably benign Het
Crlf2 A C 5: 109,557,031 F103V possibly damaging Het
Dync2h1 T C 9: 7,159,632 N652S probably benign Het
Ephx4 G A 5: 107,426,918 G274D probably damaging Het
Fer T A 17: 63,991,606 F517I probably damaging Het
Fsip2 A T 2: 82,982,787 H3150L probably benign Het
Gata3 T A 2: 9,858,528 N392Y possibly damaging Het
Gm17660 A G 5: 104,074,737 probably benign Het
Gm5136 A T 10: 108,699,590 V168E probably damaging Het
Gria4 C T 9: 4,793,822 V79M probably damaging Het
Grk3 A C 5: 112,985,775 N60K probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Igf1r T G 7: 68,004,179 I155R probably damaging Het
Igsf9 T C 1: 172,495,762 L681P probably damaging Het
Intu T C 3: 40,694,255 M789T probably benign Het
Kit A T 5: 75,607,212 Q85L probably benign Het
Klhdc2 T A 12: 69,308,976 C325* probably null Het
Mcidas A G 13: 112,993,885 E5G probably benign Het
Mcm5 G T 8: 75,127,290 R724L possibly damaging Het
Nrbp2 G A 15: 76,091,483 probably benign Het
Nrg1 A G 8: 31,818,056 I655T probably damaging Het
Nsun4 T C 4: 116,052,934 D143G possibly damaging Het
Olfr214 T C 6: 116,556,775 S117P probably damaging Het
Olfr610 A G 7: 103,506,457 V163A possibly damaging Het
Olfr74 A T 2: 87,974,170 V165E possibly damaging Het
Opn3 C T 1: 175,663,049 V349M probably damaging Het
Pank2 C A 2: 131,282,626 L297I probably damaging Het
Pcdh20 T A 14: 88,467,254 E870V probably benign Het
Pdcd6 T A 13: 74,309,840 M71L possibly damaging Het
Phkb A T 8: 86,029,617 I847F probably damaging Het
Psmb1 A G 17: 15,477,247 F202S probably benign Het
Pwp2 C G 10: 78,184,293 probably null Het
Rbms3 A G 9: 117,251,741 Y21H probably damaging Het
Rhbdl1 T A 17: 25,836,184 K17* probably null Het
Rp1l1 C A 14: 64,028,218 Q418K possibly damaging Het
Slc22a4 A T 11: 54,007,789 V159E possibly damaging Het
Spata31d1a T C 13: 59,701,963 T784A possibly damaging Het
Tll1 A G 8: 64,098,510 M279T probably damaging Het
Tmem163 A T 1: 127,551,380 V134D probably damaging Het
Top2b A G 14: 16,409,958 N875S possibly damaging Het
Tpd52l1 T C 10: 31,332,857 E205G probably benign Het
Tpsb2 T A 17: 25,367,828 Y271* probably null Het
Ugt3a1 G A 15: 9,280,052 probably null Het
Vmn2r67 T C 7: 85,152,632 M154V probably benign Het
Zfp740 T G 15: 102,208,808 I89S probably benign Het
Other mutations in Acap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Acap1 APN 11 69882691 missense possibly damaging 0.95
IGL01148:Acap1 APN 11 69890903 nonsense probably null
IGL01398:Acap1 APN 11 69881722 missense probably damaging 1.00
IGL01583:Acap1 APN 11 69881677 missense probably damaging 1.00
IGL02002:Acap1 APN 11 69884460 missense probably damaging 1.00
IGL02078:Acap1 APN 11 69895286 missense probably damaging 1.00
IGL02083:Acap1 APN 11 69889510 missense possibly damaging 0.74
IGL02535:Acap1 APN 11 69882694 missense probably benign 0.02
IGL02669:Acap1 APN 11 69894595 unclassified probably benign
IGL03125:Acap1 APN 11 69887038 missense probably damaging 1.00
autobot UTSW 11 69881722 missense probably damaging 1.00
R0127:Acap1 UTSW 11 69887217 splice site probably benign
R0243:Acap1 UTSW 11 69885426 missense probably damaging 0.98
R0604:Acap1 UTSW 11 69884625 missense probably benign 0.01
R0863:Acap1 UTSW 11 69887056 missense probably damaging 0.98
R1331:Acap1 UTSW 11 69882376 splice site probably null
R1911:Acap1 UTSW 11 69881722 missense probably damaging 1.00
R1994:Acap1 UTSW 11 69889498 missense probably benign 0.41
R2411:Acap1 UTSW 11 69885485 missense probably damaging 1.00
R2442:Acap1 UTSW 11 69889491 missense possibly damaging 0.46
R2910:Acap1 UTSW 11 69887076 splice site probably benign
R4164:Acap1 UTSW 11 69890037 missense probably benign 0.22
R4223:Acap1 UTSW 11 69883685 missense probably damaging 0.99
R4562:Acap1 UTSW 11 69885351 intron probably benign
R4676:Acap1 UTSW 11 69889468 missense probably benign 0.22
R4852:Acap1 UTSW 11 69884376 missense probably benign 0.30
R4921:Acap1 UTSW 11 69887193 missense probably damaging 0.98
R4928:Acap1 UTSW 11 69885815 missense possibly damaging 0.81
R5536:Acap1 UTSW 11 69889307 missense probably benign 0.11
R5886:Acap1 UTSW 11 69884336 missense probably benign
R6053:Acap1 UTSW 11 69887070 critical splice acceptor site probably null
R6196:Acap1 UTSW 11 69887067 missense probably damaging 0.98
R6220:Acap1 UTSW 11 69889679 missense probably damaging 0.99
R6295:Acap1 UTSW 11 69890587 critical splice donor site probably null
R6333:Acap1 UTSW 11 69883601 missense possibly damaging 0.65
R6414:Acap1 UTSW 11 69884336 missense probably benign
R6952:Acap1 UTSW 11 69885517 missense probably benign 0.30
R7243:Acap1 UTSW 11 69890471 missense probably benign 0.21
R8066:Acap1 UTSW 11 69889863 missense probably benign 0.05
X0012:Acap1 UTSW 11 69881689 missense probably damaging 1.00
X0027:Acap1 UTSW 11 69881723 missense probably damaging 1.00
Z1177:Acap1 UTSW 11 69882443 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACATACTTGGCATGAATCCAGG -3'
(R):5'- AGCCTCGGAGTTCATTTCTC -3'

Sequencing Primer
(F):5'- GCATGAATCCAGGCTTCCTTTTC -3'
(R):5'- GAGTTCATTTCTCCAAAGTCCG -3'
Posted On2018-09-12