Incidental Mutation 'R6821:Rad54b'
ID537611
Institutional Source Beutler Lab
Gene Symbol Rad54b
Ensembl Gene ENSMUSG00000078773
Gene NameRAD54 homolog B (S. cerevisiae)
SynonymsE130016E03Rik, E130016E03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6821 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location11558922-11615805 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 11612777 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 803 (D803G)
Ref Sequence ENSEMBL: ENSMUSP00000066977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070755]
Predicted Effect probably damaging
Transcript: ENSMUST00000070755
AA Change: D803G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066977
Gene: ENSMUSG00000078773
AA Change: D803G

DomainStartEndE-ValueType
low complexity region 113 121 N/A INTRINSIC
low complexity region 164 178 N/A INTRINSIC
DEXDc 270 470 4.36e-36 SMART
HELICc 652 736 6.14e-22 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the DEAD-like helicase superfamily. It shares similarity with Saccharomyces cerevisiae RAD54 and RDH54, both of which are involved in homologous recombination and repair of DNA. This protein binds to double-stranded DNA, and displays ATPase activity in the presence of DNA. This gene is highly expressed in testis and spleen, which suggests active roles in meiotic and mitotic recombination. Homozygous mutations of this gene were observed in primary lymphoma and colon cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene have an increased sensitivity to ionizing radiation and other agents of DNA damage but outherwise have a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl5 T C 19: 55,288,836 I417T probably benign Het
Adamts12 A C 15: 11,152,048 K208T probably benign Het
Adamts8 T A 9: 30,956,626 L582Q probably benign Het
Aim2 C G 1: 173,463,980 T317R probably damaging Het
Ano9 A T 7: 141,107,256 F357I possibly damaging Het
Aox3 T C 1: 58,150,388 V416A probably benign Het
Arhgap21 A C 2: 20,848,848 F1901C probably benign Het
Atp8b2 A T 3: 89,948,173 F506I probably damaging Het
Atp9b A T 18: 80,847,248 L292H probably damaging Het
C2cd5 A G 6: 143,017,986 V891A probably damaging Het
Ccnt2 T C 1: 127,803,335 S650P probably damaging Het
Cdhr3 T A 12: 33,035,045 N791Y probably damaging Het
Cmtm1 TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG 8: 104,309,702 probably null Het
D630003M21Rik A C 2: 158,204,774 L761R probably damaging Het
Draxin G T 4: 148,115,691 Q101K possibly damaging Het
Dtx3l A T 16: 35,933,060 L392Q probably damaging Het
Eif3d A G 15: 77,961,655 S389P possibly damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Epha4 T C 1: 77,382,945 N757S possibly damaging Het
Fam228b T C 12: 4,763,083 I96V probably benign Het
Gars A G 6: 55,079,338 E728G probably benign Het
Gldn T C 9: 54,338,770 M535T probably benign Het
Gm13089 A T 4: 143,699,304 L23* probably null Het
Gm47985 A G 1: 151,183,036 T143A possibly damaging Het
Gpr6 T C 10: 41,071,008 T193A probably benign Het
Grik5 C T 7: 25,046,355 R431Q possibly damaging Het
Hecw1 T A 13: 14,264,134 Y1315F probably damaging Het
Hs3st2 A G 7: 121,500,522 D197G possibly damaging Het
Igsf9 T C 1: 172,484,493 I2T probably benign Het
Ints9 A G 14: 65,037,458 E621G probably benign Het
Itm2b G A 14: 73,366,467 P47S probably benign Het
Map10 A G 8: 125,670,399 K177R probably benign Het
Mdh2 T C 5: 135,789,671 F260S possibly damaging Het
Mtmr11 A G 3: 96,170,407 T573A probably benign Het
Mycbp2 A T 14: 103,139,409 I3812N probably damaging Het
Myo15 A G 11: 60,524,475 N3403S probably damaging Het
Nvl G A 1: 181,126,970 Q343* probably null Het
Ocstamp A T 2: 165,397,922 S115T probably benign Het
Olfr632 A T 7: 103,937,586 I69F probably benign Het
Otoa G A 7: 121,092,847 probably null Het
Pcdhb20 A T 18: 37,506,122 N567I probably damaging Het
Pgm5 A T 19: 24,861,647 V48E possibly damaging Het
Phlpp1 T A 1: 106,386,444 S1182R probably damaging Het
Pik3r4 T A 9: 105,650,606 L386Q probably damaging Het
Pop1 A G 15: 34,508,639 K287E possibly damaging Het
Rbm26 G A 14: 105,116,964 probably benign Het
Rspry1 C T 8: 94,635,431 Q113* probably null Het
Siah2 T A 3: 58,691,770 S16C probably benign Het
Sirpa C A 2: 129,630,097 D481E probably damaging Het
Slc38a7 A C 8: 95,844,920 D227E probably benign Het
Smc5 A G 19: 23,242,787 V438A probably benign Het
Spast A G 17: 74,351,962 E108G probably benign Het
Speg A G 1: 75,417,903 E1752G possibly damaging Het
Tanc2 T G 11: 105,886,490 probably null Het
Tgfbi T C 13: 56,626,137 I243T possibly damaging Het
Tlr12 T C 4: 128,616,892 S522G possibly damaging Het
Trav14-3 A G 14: 53,763,472 I47V probably benign Het
Tsc22d4 T C 5: 137,762,644 V109A possibly damaging Het
Ttl G A 2: 129,068,915 R73H probably damaging Het
Usp34 C T 11: 23,367,491 T850I possibly damaging Het
Vdac3 T C 8: 22,580,475 Y140C probably damaging Het
Vmn2r120 T C 17: 57,536,659 R62G probably benign Het
Vmn2r17 T A 5: 109,429,465 Y461N probably damaging Het
Wt1 T A 2: 105,172,267 F493I probably damaging Het
Other mutations in Rad54b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00770:Rad54b APN 4 11593765 missense probably benign
IGL00774:Rad54b APN 4 11593765 missense probably benign
IGL00956:Rad54b APN 4 11597833 missense probably damaging 0.98
IGL00961:Rad54b APN 4 11599699 missense probably damaging 1.00
IGL01064:Rad54b APN 4 11604866 missense probably damaging 1.00
IGL02150:Rad54b APN 4 11610502 missense probably damaging 1.00
IGL02326:Rad54b APN 4 11612713 missense probably damaging 1.00
IGL03105:Rad54b APN 4 11615569 missense probably benign 0.00
IGL03143:Rad54b APN 4 11599755 missense probably damaging 1.00
IGL03288:Rad54b APN 4 11569833 missense possibly damaging 0.83
P0033:Rad54b UTSW 4 11609285 unclassified probably benign
R0076:Rad54b UTSW 4 11609480 unclassified probably benign
R0094:Rad54b UTSW 4 11599681 missense possibly damaging 0.92
R0391:Rad54b UTSW 4 11601702 missense probably damaging 0.98
R0441:Rad54b UTSW 4 11563394 missense probably benign 0.08
R0442:Rad54b UTSW 4 11609480 unclassified probably benign
R0442:Rad54b UTSW 4 11610362 missense probably benign 0.02
R0449:Rad54b UTSW 4 11606131 missense probably benign 0.43
R0519:Rad54b UTSW 4 11599809 missense probably damaging 1.00
R0843:Rad54b UTSW 4 11609471 critical splice donor site probably null
R1118:Rad54b UTSW 4 11563352 missense probably damaging 1.00
R1439:Rad54b UTSW 4 11606152 missense possibly damaging 0.90
R1763:Rad54b UTSW 4 11604989 missense possibly damaging 0.52
R1812:Rad54b UTSW 4 11612770 missense probably damaging 1.00
R1854:Rad54b UTSW 4 11601669 missense probably damaging 1.00
R1917:Rad54b UTSW 4 11601693 missense probably damaging 1.00
R1918:Rad54b UTSW 4 11601693 missense probably damaging 1.00
R1919:Rad54b UTSW 4 11601693 missense probably damaging 1.00
R2057:Rad54b UTSW 4 11606088 missense probably benign 0.08
R2386:Rad54b UTSW 4 11597874 missense probably benign
R2437:Rad54b UTSW 4 11606272 missense probably damaging 1.00
R4299:Rad54b UTSW 4 11597865 missense probably damaging 1.00
R4391:Rad54b UTSW 4 11615570 missense probably benign 0.00
R4672:Rad54b UTSW 4 11609449 missense probably benign 0.05
R4673:Rad54b UTSW 4 11609449 missense probably benign 0.05
R4826:Rad54b UTSW 4 11599753 missense probably damaging 1.00
R4930:Rad54b UTSW 4 11615579 missense probably damaging 0.99
R5796:Rad54b UTSW 4 11615446 missense probably benign 0.01
R5901:Rad54b UTSW 4 11595919 missense possibly damaging 0.84
R6185:Rad54b UTSW 4 11593804 missense possibly damaging 0.51
R6355:Rad54b UTSW 4 11604989 missense possibly damaging 0.52
R6576:Rad54b UTSW 4 11601577 missense probably benign
R6684:Rad54b UTSW 4 11583689 unclassified probably benign
R6947:Rad54b UTSW 4 11569859 missense possibly damaging 0.83
R7177:Rad54b UTSW 4 11599755 missense probably damaging 1.00
R7361:Rad54b UTSW 4 11599782 missense probably damaging 1.00
R7483:Rad54b UTSW 4 11610372 missense probably damaging 1.00
R7511:Rad54b UTSW 4 11578956 splice site probably null
R7847:Rad54b UTSW 4 11612655 missense probably damaging 1.00
R7908:Rad54b UTSW 4 11595868 missense probably null 0.01
R7930:Rad54b UTSW 4 11612655 missense probably damaging 1.00
R7989:Rad54b UTSW 4 11595868 missense probably null 0.01
Predicted Primers PCR Primer
(F):5'- GCTTCAACATCTGAACATCTGGAATG -3'
(R):5'- AGTACTTGCCCTACAACCCGAG -3'

Sequencing Primer
(F):5'- AGAAAATCTAATGGGTGTTTTCTCC -3'
(R):5'- GGAACAAAGAGAACTAACACGTGC -3'
Posted On2018-10-18