Incidental Mutation 'R6964:Stau2'
ID541857
Institutional Source Beutler Lab
Gene Symbol Stau2
Ensembl Gene ENSMUSG00000025920
Gene Namestaufen double-stranded RNA binding protein 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6964 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location16228674-16520112 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 16390005 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 204 (M204R)
Ref Sequence ENSEMBL: ENSMUSP00000124303 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027052] [ENSMUST00000054668] [ENSMUST00000127420] [ENSMUST00000128957] [ENSMUST00000131257] [ENSMUST00000149320] [ENSMUST00000151888] [ENSMUST00000159558] [ENSMUST00000162007] [ENSMUST00000162435] [ENSMUST00000162627] [ENSMUST00000162751]
Predicted Effect probably benign
Transcript: ENSMUST00000027052
AA Change: M204R

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000027052
Gene: ENSMUSG00000025920
AA Change: M204R

DomainStartEndE-ValueType
SCOP:d1di2a_ 5 40 3e-3 SMART
DSRM 64 148 2.36e-7 SMART
DSRM 176 241 1.84e-18 SMART
DSRM 276 342 5.45e-21 SMART
low complexity region 415 433 N/A INTRINSIC
PDB:4DKK|A 434 479 5e-6 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000054668
AA Change: M236R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000053190
Gene: ENSMUSG00000025920
AA Change: M236R

DomainStartEndE-ValueType
DSRM 9 74 1.17e-11 SMART
DSRM 96 180 2.36e-7 SMART
DSRM 208 273 1.84e-18 SMART
DSRM 308 374 5.45e-21 SMART
low complexity region 447 465 N/A INTRINSIC
PDB:4DKK|A 466 511 6e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000127420
SMART Domains Protein: ENSMUSP00000122116
Gene: ENSMUSG00000025920

DomainStartEndE-ValueType
SCOP:d1di2a_ 5 40 2e-4 SMART
Blast:DSRM 5 42 9e-17 BLAST
Blast:DSRM 64 110 2e-25 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000128957
AA Change: M236R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122410
Gene: ENSMUSG00000025920
AA Change: M236R

DomainStartEndE-ValueType
DSRM 9 74 1.17e-11 SMART
DSRM 96 180 2.36e-7 SMART
DSRM 208 273 1.84e-18 SMART
DSRM 308 374 5.45e-21 SMART
low complexity region 447 465 N/A INTRINSIC
PDB:4DKK|A 466 511 2e-6 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000131257
AA Change: M198R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121410
Gene: ENSMUSG00000025920
AA Change: M198R

DomainStartEndE-ValueType
SCOP:d1di2a_ 1 34 9e-3 SMART
DSRM 58 142 2.36e-7 SMART
DSRM 170 235 1.84e-18 SMART
DSRM 270 336 5.45e-21 SMART
low complexity region 409 427 N/A INTRINSIC
PDB:4DKK|A 428 473 2e-6 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000149320
AA Change: M236R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118489
Gene: ENSMUSG00000025920
AA Change: M236R

DomainStartEndE-ValueType
DSRM 9 74 1.17e-11 SMART
DSRM 96 180 2.36e-7 SMART
DSRM 208 273 1.84e-18 SMART
DSRM 308 374 5.45e-21 SMART
low complexity region 447 465 N/A INTRINSIC
PDB:4DKK|A 466 511 2e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000151888
SMART Domains Protein: ENSMUSP00000125473
Gene: ENSMUSG00000025920

DomainStartEndE-ValueType
Blast:DSRM 1 55 3e-35 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000159558
AA Change: M204R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125726
Gene: ENSMUSG00000025920
AA Change: M204R

DomainStartEndE-ValueType
SCOP:d1di2a_ 5 40 2e-3 SMART
DSRM 64 148 2.36e-7 SMART
DSRM 176 241 1.84e-18 SMART
DSRM 276 342 5.45e-21 SMART
low complexity region 415 433 N/A INTRINSIC
PDB:4DKK|A 434 479 2e-6 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000162007
AA Change: M204R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124303
Gene: ENSMUSG00000025920
AA Change: M204R

DomainStartEndE-ValueType
SCOP:d1di2a_ 5 40 2e-3 SMART
DSRM 64 148 2.36e-7 SMART
DSRM 176 241 1.84e-18 SMART
DSRM 276 342 5.45e-21 SMART
low complexity region 415 433 N/A INTRINSIC
PDB:4DKK|A 434 479 2e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000162435
AA Change: M204R

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000123827
Gene: ENSMUSG00000025920
AA Change: M204R

DomainStartEndE-ValueType
SCOP:d1di2a_ 5 40 3e-3 SMART
DSRM 64 148 2.36e-7 SMART
DSRM 176 241 1.84e-18 SMART
DSRM 276 342 5.45e-21 SMART
low complexity region 415 433 N/A INTRINSIC
PDB:4DKK|A 434 479 5e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000162627
AA Change: M204R

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000123781
Gene: ENSMUSG00000025920
AA Change: M204R

DomainStartEndE-ValueType
SCOP:d1di2a_ 5 40 3e-3 SMART
DSRM 64 148 2.36e-7 SMART
DSRM 176 241 1.84e-18 SMART
DSRM 276 342 5.45e-21 SMART
low complexity region 415 433 N/A INTRINSIC
PDB:4DKK|A 434 479 5e-6 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000162751
AA Change: M236R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124505
Gene: ENSMUSG00000025920
AA Change: M236R

DomainStartEndE-ValueType
DSRM 9 74 1.17e-11 SMART
DSRM 96 180 2.36e-7 SMART
DSRM 208 273 1.84e-18 SMART
DSRM 308 374 5.45e-21 SMART
Pfam:Staufen_C 455 523 6.5e-19 PFAM
Meta Mutation Damage Score 0.6538 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Staufen homolog 2 is a member of the family of double-stranded RNA (dsRNA)-binding proteins involved in the transport and/or localization of mRNAs to different subcellular compartments and/or organelles. These proteins are characterized by the presence of multiple dsRNA-binding domains which are required to bind RNAs having double-stranded secondary structures. Staufen homolog 2 shares 48.5% and 59.9% similarity with drosophila and human staufen, respectively. The exact function of Staufen homolog 2 is not known, but since it contains 3 copies of conserved dsRNA binding domain, it could be involved in double-stranded RNA binding events. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2009]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630089N07Rik A T 16: 98,065,759 Y334* probably null Het
Abcc2 A C 19: 43,798,076 I116L probably benign Het
Adamts17 T A 7: 66,909,400 Y313N possibly damaging Het
Adamts17 A G 7: 67,004,353 T444A probably benign Het
Adamtsl1 A G 4: 86,156,854 I153V probably damaging Het
Ambra1 C T 2: 91,917,416 Q1046* probably null Het
Ap1g2 A T 14: 55,099,265 V750D possibly damaging Het
Bcl7a T C 5: 123,369,456 probably null Het
C4bp A T 1: 130,657,272 L9Q probably damaging Het
Cadps2 A C 6: 23,583,459 V344G probably damaging Het
Car7 A G 8: 104,543,581 D15G possibly damaging Het
Cep126 G C 9: 8,112,100 H157Q probably null Het
Chst11 C T 10: 83,191,381 T214I probably damaging Het
Cntrob G A 11: 69,309,491 R526* probably null Het
Cul1 A G 6: 47,516,509 T445A probably benign Het
Dclre1c T C 2: 3,453,169 V363A possibly damaging Het
Ddx58 A G 4: 40,225,697 S235P probably benign Het
Dock10 T A 1: 80,503,648 probably benign Het
Donson A G 16: 91,681,219 Y465H probably benign Het
Eif3e G A 15: 43,272,289 A118V probably benign Het
Fam47e A T 5: 92,566,052 Q180L probably damaging Het
Fat1 T G 8: 45,043,945 C4156G probably damaging Het
Fermt2 A T 14: 45,465,142 I441K probably damaging Het
Frmd4b C T 6: 97,305,197 R510Q probably damaging Het
Fscn1 C T 5: 142,960,660 A71V probably damaging Het
Gfap G A 11: 102,896,957 A54V possibly damaging Het
Gjc3 C T 5: 137,957,497 M175I probably benign Het
Gm10645 C T 8: 83,165,952 probably benign Het
Haus5 G A 7: 30,657,615 P464S probably benign Het
Helz2 T A 2: 181,230,428 I2584F probably damaging Het
Mak T A 13: 41,032,591 I534L probably benign Het
Map3k9 T C 12: 81,773,003 D159G probably benign Het
Mcat A G 15: 83,547,931 probably benign Het
Meltf A G 16: 31,880,162 D30G probably benign Het
Ntng2 T A 2: 29,197,029 Y452F probably benign Het
Olfr1130 T C 2: 87,607,613 L75P probably damaging Het
Olfr1245 T A 2: 89,574,989 I246F probably benign Het
Olfr1474 T A 19: 13,471,361 Y130* probably null Het
Olfr473 A T 7: 107,933,759 I80L probably benign Het
Paip1 C T 13: 119,450,770 T390I possibly damaging Het
Pianp T A 6: 124,999,390 V54D possibly damaging Het
Ptprn T C 1: 75,260,649 D103G possibly damaging Het
Rhcg A G 7: 79,600,531 V268A probably benign Het
Rhoj T A 12: 75,375,389 Y74N probably damaging Het
Snx13 A C 12: 35,119,789 T578P possibly damaging Het
Star T A 8: 25,811,823 H227Q probably benign Het
Steap4 A G 5: 7,975,568 Y43C probably damaging Het
Syt8 A G 7: 142,439,421 E21G probably benign Het
Tacr3 T C 3: 134,829,739 V156A probably damaging Het
Tmem106b C T 6: 13,082,423 T199M probably benign Het
Tmem131 T C 1: 36,796,292 T1583A probably damaging Het
Tom1 G A 8: 75,051,965 V87I probably null Het
Treml4 G T 17: 48,272,819 probably null Het
Ttn T C 2: 76,714,113 K32843R probably damaging Het
Wdr95 T G 5: 149,581,850 C223W probably damaging Het
Wipi1 C T 11: 109,603,764 R81Q probably benign Het
Zc3h7a G A 16: 11,149,224 T568I probably benign Het
Zfp287 A T 11: 62,724,817 I228N probably damaging Het
Zfp606 T A 7: 12,489,592 V10E probably damaging Het
Other mutations in Stau2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01531:Stau2 APN 1 16345698 makesense probably null
IGL01809:Stau2 APN 1 16440315 splice site probably null
IGL01895:Stau2 APN 1 16345937 missense probably damaging 0.99
IGL02164:Stau2 APN 1 16345828 missense probably damaging 1.00
IGL02507:Stau2 APN 1 16486069 missense possibly damaging 0.93
R0124:Stau2 UTSW 1 16463128 missense probably damaging 1.00
R0595:Stau2 UTSW 1 16440450 missense probably damaging 1.00
R1104:Stau2 UTSW 1 16440361 nonsense probably null
R1296:Stau2 UTSW 1 16440372 missense probably benign
R1359:Stau2 UTSW 1 16392566 missense probably damaging 1.00
R2884:Stau2 UTSW 1 16231066 missense possibly damaging 0.81
R4066:Stau2 UTSW 1 16394059 missense possibly damaging 0.83
R4718:Stau2 UTSW 1 16346045 splice site probably null
R5496:Stau2 UTSW 1 16390021 missense probably damaging 1.00
R6232:Stau2 UTSW 1 16374811 missense probably benign 0.00
R6447:Stau2 UTSW 1 16389825 missense possibly damaging 0.92
R7317:Stau2 UTSW 1 16460329 missense unknown
R7885:Stau2 UTSW 1 16460353 missense unknown
R8142:Stau2 UTSW 1 16460351 missense unknown
R8161:Stau2 UTSW 1 16345825 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCATGTTGTGGTCCATCAATACAG -3'
(R):5'- GAGACCATGACTGACTGTAAATTAC -3'

Sequencing Primer
(F):5'- TGGATAGTCACAAGTATATGCTTACC -3'
(R):5'- ATGCTGCCATGTCGATT -3'
Posted On2018-11-28