Incidental Mutation 'R6964:Ambra1'
ID541867
Institutional Source Beutler Lab
Gene Symbol Ambra1
Ensembl Gene ENSMUSG00000040506
Gene Nameautophagy/beclin 1 regulator 1
Synonyms2310079H06Rik, D030051N19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.865) question?
Stock #R6964 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location91730134-91918849 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 91917416 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 1046 (Q1046*)
Ref Sequence ENSEMBL: ENSMUSP00000106949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045699] [ENSMUST00000045705] [ENSMUST00000099712] [ENSMUST00000111316] [ENSMUST00000111317]
Predicted Effect probably null
Transcript: ENSMUST00000045699
AA Change: Q1046*
SMART Domains Protein: ENSMUSP00000048898
Gene: ENSMUSG00000040506
AA Change: Q1046*

DomainStartEndE-ValueType
WD40 50 81 4.11e1 SMART
WD40 84 124 1.16e-9 SMART
WD40 126 164 1.19e0 SMART
low complexity region 351 361 N/A INTRINSIC
low complexity region 393 404 N/A INTRINSIC
low complexity region 538 554 N/A INTRINSIC
low complexity region 591 603 N/A INTRINSIC
low complexity region 636 643 N/A INTRINSIC
Blast:WD40 812 850 1e-5 BLAST
Blast:WD40 871 918 1e-7 BLAST
low complexity region 942 954 N/A INTRINSIC
low complexity region 1002 1026 N/A INTRINSIC
low complexity region 1127 1143 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000045705
AA Change: Q1166*
SMART Domains Protein: ENSMUSP00000049258
Gene: ENSMUSG00000040506
AA Change: Q1166*

DomainStartEndE-ValueType
WD40 50 81 4.11e1 SMART
WD40 84 124 1.16e-9 SMART
WD40 126 164 1.19e0 SMART
low complexity region 267 285 N/A INTRINSIC
low complexity region 442 452 N/A INTRINSIC
low complexity region 484 495 N/A INTRINSIC
low complexity region 629 645 N/A INTRINSIC
low complexity region 682 704 N/A INTRINSIC
low complexity region 756 763 N/A INTRINSIC
Blast:WD40 932 970 1e-5 BLAST
Blast:WD40 991 1038 1e-7 BLAST
low complexity region 1062 1074 N/A INTRINSIC
low complexity region 1122 1146 N/A INTRINSIC
low complexity region 1247 1263 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000099712
AA Change: Q1075*
SMART Domains Protein: ENSMUSP00000097299
Gene: ENSMUSG00000040506
AA Change: Q1075*

DomainStartEndE-ValueType
WD40 50 81 4.11e1 SMART
WD40 84 124 1.16e-9 SMART
WD40 126 164 1.19e0 SMART
low complexity region 351 361 N/A INTRINSIC
low complexity region 393 404 N/A INTRINSIC
low complexity region 538 554 N/A INTRINSIC
low complexity region 591 613 N/A INTRINSIC
low complexity region 665 672 N/A INTRINSIC
Blast:WD40 841 879 1e-5 BLAST
Blast:WD40 900 947 1e-7 BLAST
low complexity region 971 983 N/A INTRINSIC
low complexity region 1031 1055 N/A INTRINSIC
low complexity region 1156 1172 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111316
AA Change: Q1106*
SMART Domains Protein: ENSMUSP00000106948
Gene: ENSMUSG00000040506
AA Change: Q1106*

DomainStartEndE-ValueType
WD40 50 81 4.11e1 SMART
WD40 84 124 1.16e-9 SMART
WD40 126 164 1.19e0 SMART
low complexity region 267 285 N/A INTRINSIC
low complexity region 442 452 N/A INTRINSIC
low complexity region 484 495 N/A INTRINSIC
low complexity region 629 645 N/A INTRINSIC
low complexity region 682 704 N/A INTRINSIC
Blast:WD40 872 910 1e-5 BLAST
Blast:WD40 931 978 1e-7 BLAST
low complexity region 1002 1014 N/A INTRINSIC
low complexity region 1062 1086 N/A INTRINSIC
low complexity region 1187 1203 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111317
AA Change: Q1046*
SMART Domains Protein: ENSMUSP00000106949
Gene: ENSMUSG00000040506
AA Change: Q1046*

DomainStartEndE-ValueType
WD40 50 81 4.11e1 SMART
WD40 84 124 1.16e-9 SMART
WD40 126 164 1.19e0 SMART
low complexity region 351 361 N/A INTRINSIC
low complexity region 393 404 N/A INTRINSIC
low complexity region 538 554 N/A INTRINSIC
low complexity region 591 603 N/A INTRINSIC
low complexity region 636 643 N/A INTRINSIC
Blast:WD40 812 850 1e-5 BLAST
Blast:WD40 871 918 1e-7 BLAST
low complexity region 942 954 N/A INTRINSIC
low complexity region 1002 1026 N/A INTRINSIC
low complexity region 1127 1143 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Most mice homozygous for a gene trap mutation die at E10-E14.5 with severe neural tube defects manifest as midbrain/hindbrain exencephaly and/or spina bifida and associated with impaired autophagy, accumulation of ubiquitinated proteins, abnormal cell proliferation and excessive apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630089N07Rik A T 16: 98,065,759 Y334* probably null Het
Abcc2 A C 19: 43,798,076 I116L probably benign Het
Adamts17 T A 7: 66,909,400 Y313N possibly damaging Het
Adamts17 A G 7: 67,004,353 T444A probably benign Het
Adamtsl1 A G 4: 86,156,854 I153V probably damaging Het
Ap1g2 A T 14: 55,099,265 V750D possibly damaging Het
Bcl7a T C 5: 123,369,456 probably null Het
C4bp A T 1: 130,657,272 L9Q probably damaging Het
Cadps2 A C 6: 23,583,459 V344G probably damaging Het
Car7 A G 8: 104,543,581 D15G possibly damaging Het
Cep126 G C 9: 8,112,100 H157Q probably null Het
Chst11 C T 10: 83,191,381 T214I probably damaging Het
Cntrob G A 11: 69,309,491 R526* probably null Het
Cul1 A G 6: 47,516,509 T445A probably benign Het
Dclre1c T C 2: 3,453,169 V363A possibly damaging Het
Ddx58 A G 4: 40,225,697 S235P probably benign Het
Dock10 T A 1: 80,503,648 probably benign Het
Donson A G 16: 91,681,219 Y465H probably benign Het
Eif3e G A 15: 43,272,289 A118V probably benign Het
Fam47e A T 5: 92,566,052 Q180L probably damaging Het
Fat1 T G 8: 45,043,945 C4156G probably damaging Het
Fermt2 A T 14: 45,465,142 I441K probably damaging Het
Frmd4b C T 6: 97,305,197 R510Q probably damaging Het
Fscn1 C T 5: 142,960,660 A71V probably damaging Het
Gfap G A 11: 102,896,957 A54V possibly damaging Het
Gjc3 C T 5: 137,957,497 M175I probably benign Het
Gm10645 C T 8: 83,165,952 probably benign Het
Haus5 G A 7: 30,657,615 P464S probably benign Het
Helz2 T A 2: 181,230,428 I2584F probably damaging Het
Mak T A 13: 41,032,591 I534L probably benign Het
Map3k9 T C 12: 81,773,003 D159G probably benign Het
Mcat A G 15: 83,547,931 probably benign Het
Meltf A G 16: 31,880,162 D30G probably benign Het
Ntng2 T A 2: 29,197,029 Y452F probably benign Het
Olfr1130 T C 2: 87,607,613 L75P probably damaging Het
Olfr1245 T A 2: 89,574,989 I246F probably benign Het
Olfr1474 T A 19: 13,471,361 Y130* probably null Het
Olfr473 A T 7: 107,933,759 I80L probably benign Het
Paip1 C T 13: 119,450,770 T390I possibly damaging Het
Pianp T A 6: 124,999,390 V54D possibly damaging Het
Ptprn T C 1: 75,260,649 D103G possibly damaging Het
Rhcg A G 7: 79,600,531 V268A probably benign Het
Rhoj T A 12: 75,375,389 Y74N probably damaging Het
Snx13 A C 12: 35,119,789 T578P possibly damaging Het
Star T A 8: 25,811,823 H227Q probably benign Het
Stau2 A C 1: 16,390,005 M204R probably damaging Het
Steap4 A G 5: 7,975,568 Y43C probably damaging Het
Syt8 A G 7: 142,439,421 E21G probably benign Het
Tacr3 T C 3: 134,829,739 V156A probably damaging Het
Tmem106b C T 6: 13,082,423 T199M probably benign Het
Tmem131 T C 1: 36,796,292 T1583A probably damaging Het
Tom1 G A 8: 75,051,965 V87I probably null Het
Treml4 G T 17: 48,272,819 probably null Het
Ttn T C 2: 76,714,113 K32843R probably damaging Het
Wdr95 T G 5: 149,581,850 C223W probably damaging Het
Wipi1 C T 11: 109,603,764 R81Q probably benign Het
Zc3h7a G A 16: 11,149,224 T568I probably benign Het
Zfp287 A T 11: 62,724,817 I228N probably damaging Het
Zfp606 T A 7: 12,489,592 V10E probably damaging Het
Other mutations in Ambra1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Ambra1 APN 2 91911589 missense probably benign 0.01
IGL00861:Ambra1 APN 2 91770926 missense possibly damaging 0.81
IGL00911:Ambra1 APN 2 91767682 splice site probably benign
IGL01371:Ambra1 APN 2 91825286 missense probably damaging 1.00
IGL01532:Ambra1 APN 2 91885632 missense probably damaging 1.00
IGL01620:Ambra1 APN 2 91911412 critical splice acceptor site probably null
IGL02147:Ambra1 APN 2 91767719 missense probably benign 0.01
IGL02170:Ambra1 APN 2 91767087 missense possibly damaging 0.66
IGL02173:Ambra1 APN 2 91917668 missense probably benign
IGL02212:Ambra1 APN 2 91917361 missense probably damaging 1.00
IGL02256:Ambra1 APN 2 91769054 missense possibly damaging 0.95
IGL02319:Ambra1 APN 2 91886920 missense probably damaging 1.00
IGL02502:Ambra1 APN 2 91900532 missense probably damaging 1.00
IGL02961:Ambra1 APN 2 91911448 missense possibly damaging 0.86
R0003:Ambra1 UTSW 2 91911428 missense probably damaging 1.00
R0098:Ambra1 UTSW 2 91767711 missense possibly damaging 0.66
R0173:Ambra1 UTSW 2 91810219 splice site probably benign
R0414:Ambra1 UTSW 2 91875739 missense possibly damaging 0.84
R0579:Ambra1 UTSW 2 91824465 missense possibly damaging 0.66
R1212:Ambra1 UTSW 2 91769036 missense possibly damaging 0.94
R1241:Ambra1 UTSW 2 91770896 splice site probably benign
R1467:Ambra1 UTSW 2 91885703 missense probably damaging 1.00
R1467:Ambra1 UTSW 2 91885703 missense probably damaging 1.00
R1533:Ambra1 UTSW 2 91886865 missense probably damaging 1.00
R1916:Ambra1 UTSW 2 91911461 missense probably damaging 1.00
R2080:Ambra1 UTSW 2 91885719 missense probably damaging 1.00
R2083:Ambra1 UTSW 2 91766600 missense possibly damaging 0.83
R2112:Ambra1 UTSW 2 91875787 missense probably damaging 1.00
R2255:Ambra1 UTSW 2 91917461 missense probably damaging 1.00
R3407:Ambra1 UTSW 2 91910307 missense probably damaging 1.00
R3732:Ambra1 UTSW 2 91810131 missense probably damaging 1.00
R4111:Ambra1 UTSW 2 91900558 missense probably damaging 1.00
R4792:Ambra1 UTSW 2 91772846 missense possibly damaging 0.66
R4879:Ambra1 UTSW 2 91772694 intron probably benign
R5007:Ambra1 UTSW 2 91772310 missense possibly damaging 0.79
R5261:Ambra1 UTSW 2 91885606 missense probably damaging 1.00
R6141:Ambra1 UTSW 2 91875754 missense probably damaging 1.00
R6364:Ambra1 UTSW 2 91773316 missense possibly damaging 0.66
R6413:Ambra1 UTSW 2 91769084 missense possibly damaging 0.92
R6868:Ambra1 UTSW 2 91917533 missense possibly damaging 0.83
R6888:Ambra1 UTSW 2 91769027 missense probably damaging 1.00
R6970:Ambra1 UTSW 2 91772600 intron probably benign
R6982:Ambra1 UTSW 2 91917473 missense probably damaging 1.00
R7205:Ambra1 UTSW 2 91767758 missense possibly damaging 0.46
R7458:Ambra1 UTSW 2 91917684 missense probably benign 0.26
R7786:Ambra1 UTSW 2 91767796 missense possibly damaging 0.46
R7812:Ambra1 UTSW 2 91766566 start codon destroyed probably benign 0.00
R7825:Ambra1 UTSW 2 91767761 missense probably damaging 1.00
R7860:Ambra1 UTSW 2 91773493 missense probably benign 0.27
R8190:Ambra1 UTSW 2 91772352 missense possibly damaging 0.95
R8779:Ambra1 UTSW 2 91917374 missense probably benign 0.05
Z1177:Ambra1 UTSW 2 91768999 missense possibly damaging 0.81
Z1177:Ambra1 UTSW 2 91875786 missense probably damaging 0.97
Z1177:Ambra1 UTSW 2 91900608 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GGACTTCAGTTTTCACAGTGG -3'
(R):5'- AGTTGCCCAGGTTCTGATGG -3'

Sequencing Primer
(F):5'- TACAATCCCCCAGTGTCTGCTAG -3'
(R):5'- CAGGTTCTGATGGCAGTCCTC -3'
Posted On2018-11-28