Mutagenetix > Incidental Mutation

Incidental Mutation 'R6964:Ambra1'

541867

Institutional Source

Beutler Lab

Gene Symbol

Ambra1

Ensembl Gene

ENSMUSG00000040506

Gene Name

autophagy/beclin 1 regulator 1

Synonyms

2310079H06Rik, D030051N19Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.893) question?

Stock #

R6964 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

91730134-91918849 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 91917416 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 1046 (Q1046*)

Ref Sequence

ENSEMBL: ENSMUSP00000106949 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045699] [ENSMUST00000045705] [ENSMUST00000099712] [ENSMUST00000111316] [ENSMUST00000111317]

AlphaFold

A2AH22

Predicted Effect

probably null
Transcript: ENSMUST00000045699
AA Change: Q1046*

SMART Domains

Protein: ENSMUSP00000048898
Gene: ENSMUSG00000040506
AA Change: Q1046*

Domain	Start	End	E-Value	Type
WD40	50	81	4.11e1	SMART
WD40	84	124	1.16e-9	SMART
WD40	126	164	1.19e0	SMART
low complexity region	351	361	N/A	INTRINSIC
low complexity region	393	404	N/A	INTRINSIC
low complexity region	538	554	N/A	INTRINSIC
low complexity region	591	603	N/A	INTRINSIC
low complexity region	636	643	N/A	INTRINSIC
Blast:WD40	812	850	1e-5	BLAST
Blast:WD40	871	918	1e-7	BLAST
low complexity region	942	954	N/A	INTRINSIC
low complexity region	1002	1026	N/A	INTRINSIC
low complexity region	1127	1143	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000045705
AA Change: Q1166*

SMART Domains

Protein: ENSMUSP00000049258
Gene: ENSMUSG00000040506
AA Change: Q1166*

Domain	Start	End	E-Value	Type
WD40	50	81	4.11e1	SMART
WD40	84	124	1.16e-9	SMART
WD40	126	164	1.19e0	SMART
low complexity region	267	285	N/A	INTRINSIC
low complexity region	442	452	N/A	INTRINSIC
low complexity region	484	495	N/A	INTRINSIC
low complexity region	629	645	N/A	INTRINSIC
low complexity region	682	704	N/A	INTRINSIC
low complexity region	756	763	N/A	INTRINSIC
Blast:WD40	932	970	1e-5	BLAST
Blast:WD40	991	1038	1e-7	BLAST
low complexity region	1062	1074	N/A	INTRINSIC
low complexity region	1122	1146	N/A	INTRINSIC
low complexity region	1247	1263	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000099712
AA Change: Q1075*

SMART Domains

Protein: ENSMUSP00000097299
Gene: ENSMUSG00000040506
AA Change: Q1075*

Domain	Start	End	E-Value	Type
WD40	50	81	4.11e1	SMART
WD40	84	124	1.16e-9	SMART
WD40	126	164	1.19e0	SMART
low complexity region	351	361	N/A	INTRINSIC
low complexity region	393	404	N/A	INTRINSIC
low complexity region	538	554	N/A	INTRINSIC
low complexity region	591	613	N/A	INTRINSIC
low complexity region	665	672	N/A	INTRINSIC
Blast:WD40	841	879	1e-5	BLAST
Blast:WD40	900	947	1e-7	BLAST
low complexity region	971	983	N/A	INTRINSIC
low complexity region	1031	1055	N/A	INTRINSIC
low complexity region	1156	1172	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000111316
AA Change: Q1106*

SMART Domains

Protein: ENSMUSP00000106948
Gene: ENSMUSG00000040506
AA Change: Q1106*

Domain	Start	End	E-Value	Type
WD40	50	81	4.11e1	SMART
WD40	84	124	1.16e-9	SMART
WD40	126	164	1.19e0	SMART
low complexity region	267	285	N/A	INTRINSIC
low complexity region	442	452	N/A	INTRINSIC
low complexity region	484	495	N/A	INTRINSIC
low complexity region	629	645	N/A	INTRINSIC
low complexity region	682	704	N/A	INTRINSIC
Blast:WD40	872	910	1e-5	BLAST
Blast:WD40	931	978	1e-7	BLAST
low complexity region	1002	1014	N/A	INTRINSIC
low complexity region	1062	1086	N/A	INTRINSIC
low complexity region	1187	1203	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000111317
AA Change: Q1046*

SMART Domains

Protein: ENSMUSP00000106949
Gene: ENSMUSG00000040506
AA Change: Q1046*

Domain	Start	End	E-Value	Type
WD40	50	81	4.11e1	SMART
WD40	84	124	1.16e-9	SMART
WD40	126	164	1.19e0	SMART
low complexity region	351	361	N/A	INTRINSIC
low complexity region	393	404	N/A	INTRINSIC
low complexity region	538	554	N/A	INTRINSIC
low complexity region	591	603	N/A	INTRINSIC
low complexity region	636	643	N/A	INTRINSIC
Blast:WD40	812	850	1e-5	BLAST
Blast:WD40	871	918	1e-7	BLAST
low complexity region	942	954	N/A	INTRINSIC
low complexity region	1002	1026	N/A	INTRINSIC
low complexity region	1127	1143	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.9%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Most mice homozygous for a gene trap mutation die at E10-E14.5 with severe neural tube defects manifest as midbrain/hindbrain exencephaly and/or spina bifida and associated with impaired autophagy, accumulation of ubiquitinated proteins, abnormal cell proliferation and excessive apoptosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A630089N07Rik	A	T	16: 98,065,759	Y334*	probably null	Het
Abcc2	A	C	19: 43,798,076	I116L	probably benign	Het
Adamts17	T	A	7: 66,909,400	Y313N	possibly damaging	Het
Adamts17	A	G	7: 67,004,353	T444A	probably benign	Het
Adamtsl1	A	G	4: 86,156,854	I153V	probably damaging	Het
Ap1g2	A	T	14: 55,099,265	V750D	possibly damaging	Het
Bcl7a	T	C	5: 123,369,456		probably null	Het
C4bp	A	T	1: 130,657,272	L9Q	probably damaging	Het
Cadps2	A	C	6: 23,583,459	V344G	probably damaging	Het
Car7	A	G	8: 104,543,581	D15G	possibly damaging	Het
Cep126	G	C	9: 8,112,100	H157Q	probably null	Het
Chst11	C	T	10: 83,191,381	T214I	probably damaging	Het
Cntrob	G	A	11: 69,309,491	R526*	probably null	Het
Cul1	A	G	6: 47,516,509	T445A	probably benign	Het
Dclre1c	T	C	2: 3,453,169	V363A	possibly damaging	Het
Ddx58	A	G	4: 40,225,697	S235P	probably benign	Het
Dock10	T	A	1: 80,503,648		probably benign	Het
Donson	A	G	16: 91,681,219	Y465H	probably benign	Het
Eif3e	G	A	15: 43,272,289	A118V	probably benign	Het
Fam47e	A	T	5: 92,566,052	Q180L	probably damaging	Het
Fat1	T	G	8: 45,043,945	C4156G	probably damaging	Het
Fermt2	A	T	14: 45,465,142	I441K	probably damaging	Het
Frmd4b	C	T	6: 97,305,197	R510Q	probably damaging	Het
Fscn1	C	T	5: 142,960,660	A71V	probably damaging	Het
Gfap	G	A	11: 102,896,957	A54V	possibly damaging	Het
Gjc3	C	T	5: 137,957,497	M175I	probably benign	Het
Gm10645	C	T	8: 83,165,952		probably benign	Het
Haus5	G	A	7: 30,657,615	P464S	probably benign	Het
Helz2	T	A	2: 181,230,428	I2584F	probably damaging	Het
Mak	T	A	13: 41,032,591	I534L	probably benign	Het
Map3k9	T	C	12: 81,773,003	D159G	probably benign	Het
Mcat	A	G	15: 83,547,931		probably benign	Het
Meltf	A	G	16: 31,880,162	D30G	probably benign	Het
Ntng2	T	A	2: 29,197,029	Y452F	probably benign	Het
Olfr1130	T	C	2: 87,607,613	L75P	probably damaging	Het
Olfr1245	T	A	2: 89,574,989	I246F	probably benign	Het
Olfr1474	T	A	19: 13,471,361	Y130*	probably null	Het
Olfr473	A	T	7: 107,933,759	I80L	probably benign	Het
Paip1	C	T	13: 119,450,770	T390I	possibly damaging	Het
Pianp	T	A	6: 124,999,390	V54D	possibly damaging	Het
Ptprn	T	C	1: 75,260,649	D103G	possibly damaging	Het
Rhcg	A	G	7: 79,600,531	V268A	probably benign	Het
Rhoj	T	A	12: 75,375,389	Y74N	probably damaging	Het
Snx13	A	C	12: 35,119,789	T578P	possibly damaging	Het
Star	T	A	8: 25,811,823	H227Q	probably benign	Het
Stau2	A	C	1: 16,390,005	M204R	probably damaging	Het
Steap4	A	G	5: 7,975,568	Y43C	probably damaging	Het
Syt8	A	G	7: 142,439,421	E21G	probably benign	Het
Tacr3	T	C	3: 134,829,739	V156A	probably damaging	Het
Tmem106b	C	T	6: 13,082,423	T199M	probably benign	Het
Tmem131	T	C	1: 36,796,292	T1583A	probably damaging	Het
Tom1	G	A	8: 75,051,965	V87I	probably null	Het
Treml4	G	T	17: 48,272,819		probably null	Het
Ttn	T	C	2: 76,714,113	K32843R	probably damaging	Het
Wdr95	T	G	5: 149,581,850	C223W	probably damaging	Het
Wipi1	C	T	11: 109,603,764	R81Q	probably benign	Het
Zc3h7a	G	A	16: 11,149,224	T568I	probably benign	Het
Zfp287	A	T	11: 62,724,817	I228N	probably damaging	Het
Zfp606	T	A	7: 12,489,592	V10E	probably damaging	Het

Other mutations in Ambra1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00264:Ambra1	APN	2	91911589	missense	probably benign	0.01
IGL00861:Ambra1	APN	2	91770926	missense	possibly damaging	0.81
IGL00911:Ambra1	APN	2	91767682	splice site	probably benign
IGL01371:Ambra1	APN	2	91825286	missense	probably damaging	1.00
IGL01532:Ambra1	APN	2	91885632	missense	probably damaging	1.00
IGL01620:Ambra1	APN	2	91911412	critical splice acceptor site	probably null
IGL02147:Ambra1	APN	2	91767719	missense	probably benign	0.01
IGL02170:Ambra1	APN	2	91767087	missense	possibly damaging	0.66
IGL02173:Ambra1	APN	2	91917668	missense	probably benign
IGL02212:Ambra1	APN	2	91917361	missense	probably damaging	1.00
IGL02256:Ambra1	APN	2	91769054	missense	possibly damaging	0.95
IGL02319:Ambra1	APN	2	91886920	missense	probably damaging	1.00
IGL02502:Ambra1	APN	2	91900532	missense	probably damaging	1.00
IGL02961:Ambra1	APN	2	91911448	missense	possibly damaging	0.86
R0003:Ambra1	UTSW	2	91911428	missense	probably damaging	1.00
R0098:Ambra1	UTSW	2	91767711	missense	possibly damaging	0.66
R0173:Ambra1	UTSW	2	91810219	splice site	probably benign
R0414:Ambra1	UTSW	2	91875739	missense	possibly damaging	0.84
R0579:Ambra1	UTSW	2	91824465	missense	possibly damaging	0.66
R1212:Ambra1	UTSW	2	91769036	missense	possibly damaging	0.94
R1241:Ambra1	UTSW	2	91770896	splice site	probably benign
R1467:Ambra1	UTSW	2	91885703	missense	probably damaging	1.00
R1467:Ambra1	UTSW	2	91885703	missense	probably damaging	1.00
R1533:Ambra1	UTSW	2	91886865	missense	probably damaging	1.00
R1916:Ambra1	UTSW	2	91911461	missense	probably damaging	1.00
R2080:Ambra1	UTSW	2	91885719	missense	probably damaging	1.00
R2083:Ambra1	UTSW	2	91766600	missense	possibly damaging	0.83
R2112:Ambra1	UTSW	2	91875787	missense	probably damaging	1.00
R2255:Ambra1	UTSW	2	91917461	missense	probably damaging	1.00
R3407:Ambra1	UTSW	2	91910307	missense	probably damaging	1.00
R3732:Ambra1	UTSW	2	91810131	missense	probably damaging	1.00
R4111:Ambra1	UTSW	2	91900558	missense	probably damaging	1.00
R4792:Ambra1	UTSW	2	91772846	missense	possibly damaging	0.66
R4879:Ambra1	UTSW	2	91772694	intron	probably benign
R5007:Ambra1	UTSW	2	91772310	missense	possibly damaging	0.79
R5261:Ambra1	UTSW	2	91885606	missense	probably damaging	1.00
R6141:Ambra1	UTSW	2	91875754	missense	probably damaging	1.00
R6364:Ambra1	UTSW	2	91773316	missense	possibly damaging	0.66
R6413:Ambra1	UTSW	2	91769084	missense	possibly damaging	0.92
R6868:Ambra1	UTSW	2	91917533	missense	possibly damaging	0.83
R6888:Ambra1	UTSW	2	91769027	missense	probably damaging	1.00
R6970:Ambra1	UTSW	2	91772600	intron	probably benign
R6982:Ambra1	UTSW	2	91917473	missense	probably damaging	1.00
R7205:Ambra1	UTSW	2	91767758	missense	possibly damaging	0.46
R7458:Ambra1	UTSW	2	91917684	missense	probably benign	0.26
R7786:Ambra1	UTSW	2	91767796	missense	possibly damaging	0.46
R7812:Ambra1	UTSW	2	91766566	start codon destroyed	probably benign	0.00
R7825:Ambra1	UTSW	2	91767761	missense	probably damaging	1.00
R7860:Ambra1	UTSW	2	91773493	missense	probably benign	0.27
R8190:Ambra1	UTSW	2	91772352	missense	possibly damaging	0.95
R8779:Ambra1	UTSW	2	91917374	missense	probably benign	0.05
R9044:Ambra1	UTSW	2	91910089	intron	probably benign
R9062:Ambra1	UTSW	2	91910317	missense	possibly damaging	0.82
R9707:Ambra1	UTSW	2	91810131	missense	probably damaging	1.00
Z1177:Ambra1	UTSW	2	91768999	missense	possibly damaging	0.81
Z1177:Ambra1	UTSW	2	91875786	missense	probably damaging	0.97
Z1177:Ambra1	UTSW	2	91900608	missense	possibly damaging	0.82

Predicted Primers

PCR Primer
(F):5'- GGACTTCAGTTTTCACAGTGG -3'
(R):5'- AGTTGCCCAGGTTCTGATGG -3'

Sequencing Primer
(F):5'- TACAATCCCCCAGTGTCTGCTAG -3'
(R):5'- CAGGTTCTGATGGCAGTCCTC -3'

Posted On

2018-11-28