Incidental Mutation 'R6964:Ddx58'
ID541870
Institutional Source Beutler Lab
Gene Symbol Ddx58
Ensembl Gene ENSMUSG00000040296
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 58
SynonymsRIG-I, 6430573D20Rik
MMRRC Submission
Accession Numbers

Genbank: NM_172689; MGI:2442858

Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R6964 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location40203773-40239828 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 40225697 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 235 (S235P)
Ref Sequence ENSEMBL: ENSMUSP00000042433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037907] [ENSMUST00000142055]
PDB Structure Mouse RIG-I ATPase Domain [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000037907
AA Change: S235P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000042433
Gene: ENSMUSG00000040296
AA Change: S235P

DomainStartEndE-ValueType
Pfam:CARD_2 1 93 1.2e-31 PFAM
Pfam:CARD_2 99 189 6.2e-28 PFAM
DEXDc 240 453 8.61e-26 SMART
low complexity region 582 600 N/A INTRINSIC
HELICc 642 735 1.32e-12 SMART
Pfam:RIG-I_C-RD 807 924 4.4e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142055
AA Change: S190P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000115052
Gene: ENSMUSG00000040296
AA Change: S190P

DomainStartEndE-ValueType
PDB:4NQK|D 1 153 3e-53 PDB
DEXDc 195 408 8.61e-26 SMART
low complexity region 537 555 N/A INTRINSIC
HELICc 597 690 1.32e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases which are implicated in a number of cellular processes involving RNA binding and alteration of RNA secondary structure. This gene encodes a protein containing RNA helicase-DEAD box protein motifs and a caspase recruitment domain (CARD). It is involved in viral double-stranded (ds) RNA recognition and the regulation of immune response. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most homozygotes for a null allele die in utero with liver apoptosis while survivors show impaired IFN induction and succumb to infection with certain RNA viruses. Homozygotes for another null allele are viable but develop colitis and progressive granulocytosis leading to chronic myeloid leukemia. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, knock-out(2) Gene trapped(7)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630089N07Rik A T 16: 98,065,759 Y334* probably null Het
Abcc2 A C 19: 43,798,076 I116L probably benign Het
Adamts17 T A 7: 66,909,400 Y313N possibly damaging Het
Adamts17 A G 7: 67,004,353 T444A probably benign Het
Adamtsl1 A G 4: 86,156,854 I153V probably damaging Het
Ambra1 C T 2: 91,917,416 Q1046* probably null Het
Ap1g2 A T 14: 55,099,265 V750D possibly damaging Het
Bcl7a T C 5: 123,369,456 probably null Het
C4bp A T 1: 130,657,272 L9Q probably damaging Het
Cadps2 A C 6: 23,583,459 V344G probably damaging Het
Car7 A G 8: 104,543,581 D15G possibly damaging Het
Cep126 G C 9: 8,112,100 H157Q probably null Het
Chst11 C T 10: 83,191,381 T214I probably damaging Het
Cntrob G A 11: 69,309,491 R526* probably null Het
Cul1 A G 6: 47,516,509 T445A probably benign Het
Dclre1c T C 2: 3,453,169 V363A possibly damaging Het
Dock10 T A 1: 80,503,648 probably benign Het
Donson A G 16: 91,681,219 Y465H probably benign Het
Eif3e G A 15: 43,272,289 A118V probably benign Het
Fam47e A T 5: 92,566,052 Q180L probably damaging Het
Fat1 T G 8: 45,043,945 C4156G probably damaging Het
Fermt2 A T 14: 45,465,142 I441K probably damaging Het
Frmd4b C T 6: 97,305,197 R510Q probably damaging Het
Fscn1 C T 5: 142,960,660 A71V probably damaging Het
Gfap G A 11: 102,896,957 A54V possibly damaging Het
Gjc3 C T 5: 137,957,497 M175I probably benign Het
Gm10645 C T 8: 83,165,952 probably benign Het
Haus5 G A 7: 30,657,615 P464S probably benign Het
Helz2 T A 2: 181,230,428 I2584F probably damaging Het
Mak T A 13: 41,032,591 I534L probably benign Het
Map3k9 T C 12: 81,773,003 D159G probably benign Het
Mcat A G 15: 83,547,931 probably benign Het
Meltf A G 16: 31,880,162 D30G probably benign Het
Ntng2 T A 2: 29,197,029 Y452F probably benign Het
Olfr1130 T C 2: 87,607,613 L75P probably damaging Het
Olfr1245 T A 2: 89,574,989 I246F probably benign Het
Olfr1474 T A 19: 13,471,361 Y130* probably null Het
Olfr473 A T 7: 107,933,759 I80L probably benign Het
Paip1 C T 13: 119,450,770 T390I possibly damaging Het
Pianp T A 6: 124,999,390 V54D possibly damaging Het
Ptprn T C 1: 75,260,649 D103G possibly damaging Het
Rhcg A G 7: 79,600,531 V268A probably benign Het
Rhoj T A 12: 75,375,389 Y74N probably damaging Het
Snx13 A C 12: 35,119,789 T578P possibly damaging Het
Star T A 8: 25,811,823 H227Q probably benign Het
Stau2 A C 1: 16,390,005 M204R probably damaging Het
Steap4 A G 5: 7,975,568 Y43C probably damaging Het
Syt8 A G 7: 142,439,421 E21G probably benign Het
Tacr3 T C 3: 134,829,739 V156A probably damaging Het
Tmem106b C T 6: 13,082,423 T199M probably benign Het
Tmem131 T C 1: 36,796,292 T1583A probably damaging Het
Tom1 G A 8: 75,051,965 V87I probably null Het
Treml4 G T 17: 48,272,819 probably null Het
Ttn T C 2: 76,714,113 K32843R probably damaging Het
Wdr95 T G 5: 149,581,850 C223W probably damaging Het
Wipi1 C T 11: 109,603,764 R81Q probably benign Het
Zc3h7a G A 16: 11,149,224 T568I probably benign Het
Zfp287 A T 11: 62,724,817 I228N probably damaging Het
Zfp606 T A 7: 12,489,592 V10E probably damaging Het
Other mutations in Ddx58
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Ddx58 APN 4 40220389 splice site probably benign
IGL01344:Ddx58 APN 4 40208883 missense probably damaging 0.99
IGL01414:Ddx58 APN 4 40222176 missense probably damaging 1.00
IGL01529:Ddx58 APN 4 40225685 missense probably benign
IGL01756:Ddx58 APN 4 40209934 missense probably damaging 1.00
IGL02023:Ddx58 APN 4 40216487 missense possibly damaging 0.76
IGL02223:Ddx58 APN 4 40209993 missense possibly damaging 0.48
IGL02458:Ddx58 APN 4 40229536 missense probably damaging 0.98
IGL02937:Ddx58 APN 4 40229661 missense probably benign 0.00
IGL03358:Ddx58 APN 4 40206069 missense possibly damaging 0.54
E2594:Ddx58 UTSW 4 40235282 nonsense probably null
R0324:Ddx58 UTSW 4 40213766 missense probably benign 0.24
R0400:Ddx58 UTSW 4 40235257 missense probably benign 0.00
R0518:Ddx58 UTSW 4 40216354 critical splice donor site probably null
R0834:Ddx58 UTSW 4 40239596 missense possibly damaging 0.64
R1474:Ddx58 UTSW 4 40208868 missense possibly damaging 0.62
R1611:Ddx58 UTSW 4 40223862 missense probably damaging 1.00
R1803:Ddx58 UTSW 4 40224013 missense probably benign 0.00
R1906:Ddx58 UTSW 4 40206054 missense probably benign 0.01
R2072:Ddx58 UTSW 4 40224069 splice site probably null
R4696:Ddx58 UTSW 4 40203798 unclassified probably benign
R4860:Ddx58 UTSW 4 40210000 missense probably damaging 0.97
R4860:Ddx58 UTSW 4 40210000 missense probably damaging 0.97
R5027:Ddx58 UTSW 4 40208845 missense probably benign
R5568:Ddx58 UTSW 4 40222140 missense probably benign
R6144:Ddx58 UTSW 4 40229551 missense probably benign 0.21
R6341:Ddx58 UTSW 4 40222199 critical splice acceptor site probably null
R6373:Ddx58 UTSW 4 40216487 missense possibly damaging 0.76
R6454:Ddx58 UTSW 4 40220456 missense probably damaging 0.99
R6456:Ddx58 UTSW 4 40213838 missense possibly damaging 0.73
R6523:Ddx58 UTSW 4 40205947 missense probably benign 0.00
R6593:Ddx58 UTSW 4 40226651 missense probably benign 0.02
R6741:Ddx58 UTSW 4 40211624 missense probably damaging 1.00
R7149:Ddx58 UTSW 4 40222079 missense possibly damaging 0.64
R7159:Ddx58 UTSW 4 40213804 missense probably benign 0.29
R7237:Ddx58 UTSW 4 40205938 missense probably benign 0.10
R7352:Ddx58 UTSW 4 40239668 missense probably benign 0.00
R7356:Ddx58 UTSW 4 40226600 missense probably benign 0.01
R7611:Ddx58 UTSW 4 40225651 missense probably damaging 1.00
R7615:Ddx58 UTSW 4 40229653 missense possibly damaging 0.59
R7729:Ddx58 UTSW 4 40206034 missense possibly damaging 0.53
R7759:Ddx58 UTSW 4 40225104 missense probably damaging 1.00
R7800:Ddx58 UTSW 4 40211618 missense probably benign 0.35
R7965:Ddx58 UTSW 4 40223824 nonsense probably null
R7976:Ddx58 UTSW 4 40209894 missense probably damaging 1.00
R8531:Ddx58 UTSW 4 40225596 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGGAAAACTCCTCCTTTTACAGC -3'
(R):5'- GAATTAGGCCATTCTTGCTGTCC -3'

Sequencing Primer
(F):5'- TCCTTTTACAGCCCCCAAAGG -3'
(R):5'- TTCAGCGTTTAAGAGCACCG -3'
Posted On2018-11-28