Incidental Mutation 'R6988:Tekt2'
ID543068
Institutional Source Beutler Lab
Gene Symbol Tekt2
Ensembl Gene ENSMUSG00000028845
Gene Nametektin 2
Synonymstektin-t
Accession Numbers

Genbank: NM_011902.2; Ensembl: ENSMUST00000102616

Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock #R6988 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location126322121-126325688 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 126323443 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 221 (F221L)
Ref Sequence ENSEMBL: ENSMUSP00000099676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030658] [ENSMUST00000102616] [ENSMUST00000102617] [ENSMUST00000131113] [ENSMUST00000141990]
Predicted Effect probably benign
Transcript: ENSMUST00000030658
AA Change: F221L

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000030658
Gene: ENSMUSG00000028845
AA Change: F221L

DomainStartEndE-ValueType
Pfam:Tektin 17 399 2.1e-133 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102616
AA Change: F221L

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000099676
Gene: ENSMUSG00000028845
AA Change: F221L

DomainStartEndE-ValueType
Pfam:Tektin 17 398 1.9e-131 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102617
SMART Domains Protein: ENSMUSP00000099677
Gene: ENSMUSG00000042558

DomainStartEndE-ValueType
low complexity region 2 27 N/A INTRINSIC
Pfam:ADP_ribosyl_GH 31 344 1.5e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131113
SMART Domains Protein: ENSMUSP00000116659
Gene: ENSMUSG00000028845

DomainStartEndE-ValueType
Pfam:Tektin 17 126 9.7e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141990
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the tektin family of proteins. Tektins comprise a family of filament-forming proteins that are coassembled with tubulins to form ciliary and flagellar microtubules. This gene is expressed in the testis and its protein is localized to the flagella of the sperms, indicating that it may play a role in spermatogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit male infertility and impaired motility of both sperm flagella and tracheal cilia due to altered dynein inner arm morphology and function. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Gene trapped(2)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik T G 4: 137,454,579 L15W probably damaging Het
4930550C14Rik G A 9: 53,411,756 V31I possibly damaging Het
4932415D10Rik T C 10: 82,291,899 D1759G possibly damaging Het
Adgre1 C T 17: 57,408,445 S255F probably benign Het
Aff4 T G 11: 53,398,237 S404R probably damaging Het
Akr1c19 A T 13: 4,233,758 probably benign Het
Ankrd31 T A 13: 96,878,249 I1342K probably damaging Het
Arhgap5 T A 12: 52,518,125 D626E possibly damaging Het
Arhgef1 G A 7: 24,916,923 V332I probably benign Het
AY358078 A G 14: 51,826,187 E430G probably damaging Het
B4gat1 T A 19: 5,040,434 I395N probably benign Het
Bub1b T A 2: 118,636,830 I878N probably damaging Het
Ccdc150 C T 1: 54,355,709 Q745* probably null Het
Ccl19 A T 4: 42,754,885 I87N probably damaging Het
Ces2g G C 8: 104,963,908 G107A probably benign Het
Chpt1 A G 10: 88,488,406 V180A probably damaging Het
Col2a1 T C 15: 98,004,454 T14A unknown Het
Dnah7a T C 1: 53,582,625 I1114V possibly damaging Het
Dnah7c T C 1: 46,666,213 I2462T possibly damaging Het
Dnah8 T C 17: 30,643,275 F208S probably damaging Het
Dnhd1 A G 7: 105,714,210 E3993G probably damaging Het
Erv3 C T 2: 131,855,966 D158N possibly damaging Het
Exoc6 T A 19: 37,609,091 F647I probably damaging Het
Fbrs G A 7: 127,479,508 probably benign Het
Fgfr1op2 T C 6: 146,589,965 F109L probably damaging Het
Fv1 T C 4: 147,869,271 F98S possibly damaging Het
Gm436 A G 4: 144,686,325 F15S probably benign Het
H2-M10.1 T C 17: 36,325,592 K107E probably benign Het
Hspg2 A T 4: 137,528,890 Q1436L probably damaging Het
Ighv1-74 T C 12: 115,802,763 Y79C probably damaging Het
Kcnj1 G A 9: 32,396,585 V102I probably benign Het
Mnt C A 11: 74,842,809 probably benign Het
Mrpl15 T C 1: 4,782,660 T112A probably benign Het
Ncdn T C 4: 126,747,189 D506G probably benign Het
Ogdh C T 11: 6,313,806 R81* probably null Het
Olfr791 T A 10: 129,526,673 S149T probably benign Het
Olfr815 G C 10: 129,902,409 F100L probably damaging Het
Pole G T 5: 110,329,583 V1863F probably damaging Het
Pramel5 T C 4: 144,274,007 probably benign Het
Rabep1 A G 11: 70,934,537 K636E probably damaging Het
Rasgrf2 T A 13: 91,885,635 Y1151F probably benign Het
Rrad A G 8: 104,630,636 V93A probably damaging Het
Sesn3 A T 9: 14,310,257 R118* probably null Het
Slc27a3 T C 3: 90,386,290 N596S probably benign Het
Snx19 C A 9: 30,428,935 D456E probably damaging Het
Supt20 T C 3: 54,698,597 S35P probably damaging Het
Syde2 G T 3: 146,019,809 R885L probably benign Het
Synm G A 7: 67,733,658 L1419F probably damaging Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Tmem39b A G 4: 129,693,148 I90T possibly damaging Het
Trib2 A G 12: 15,815,338 S79P probably damaging Het
Usp32 T C 11: 85,010,143 M1084V probably benign Het
Vmn1r181 T C 7: 23,984,847 F246L probably damaging Het
Wnt16 A G 6: 22,288,511 D2G probably damaging Het
Zfp462 A G 4: 55,080,716 E1357G probably benign Het
Zhx3 A G 2: 160,779,868 M793T probably benign Het
Other mutations in Tekt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Tekt2 APN 4 126323189 missense possibly damaging 0.47
IGL01900:Tekt2 APN 4 126324628 missense probably benign 0.00
IGL02452:Tekt2 APN 4 126324852 missense possibly damaging 0.83
IGL02563:Tekt2 APN 4 126324625 missense possibly damaging 0.82
IGL03087:Tekt2 APN 4 126324867 missense possibly damaging 0.63
1mM(1):Tekt2 UTSW 4 126324610 missense probably damaging 0.98
R0747:Tekt2 UTSW 4 126323760 nonsense probably null
R1113:Tekt2 UTSW 4 126324918 missense probably damaging 0.99
R1308:Tekt2 UTSW 4 126324918 missense probably damaging 0.99
R1524:Tekt2 UTSW 4 126323649 missense probably benign
R1563:Tekt2 UTSW 4 126323407 missense probably benign 0.16
R1819:Tekt2 UTSW 4 126323736 missense probably damaging 1.00
R1930:Tekt2 UTSW 4 126322817 splice site probably null
R1931:Tekt2 UTSW 4 126322817 splice site probably null
R2295:Tekt2 UTSW 4 126323693 unclassified probably null
R4888:Tekt2 UTSW 4 126324667 missense probably benign 0.02
R4902:Tekt2 UTSW 4 126323470 missense possibly damaging 0.95
R5202:Tekt2 UTSW 4 126324670 missense probably benign 0.41
R5219:Tekt2 UTSW 4 126322264 missense possibly damaging 0.51
R5839:Tekt2 UTSW 4 126322836 missense probably damaging 1.00
R6213:Tekt2 UTSW 4 126323196 missense probably damaging 0.99
R6498:Tekt2 UTSW 4 126324305 missense probably benign 0.01
R6963:Tekt2 UTSW 4 126324317 missense probably damaging 0.98
R7148:Tekt2 UTSW 4 126322381 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- AGCGTCCAGTTCATTGTTGG -3'
(R):5'- AGTCAGTCCTTTCTGTGTGC -3'

Sequencing Primer
(F):5'- CCAGAAGAGGGTGTCATGGCC -3'
(R):5'- GCCTTGTGTGTCCCTGTGAC -3'
Posted On2018-11-28