Incidental Mutation 'R6988:Sesn3'
ID543086
Institutional Source Beutler Lab
Gene Symbol Sesn3
Ensembl Gene ENSMUSG00000032009
Gene Namesestrin 3
Synonyms5630400E15Rik, SEST3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6988 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location14275067-14333101 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 14310257 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 118 (R118*)
Ref Sequence ENSEMBL: ENSMUSP00000146362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034507] [ENSMUST00000208222] [ENSMUST00000209187]
Predicted Effect probably null
Transcript: ENSMUST00000034507
AA Change: R40*
SMART Domains Protein: ENSMUSP00000034507
Gene: ENSMUSG00000032009
AA Change: R40*

DomainStartEndE-ValueType
low complexity region 6 12 N/A INTRINSIC
Pfam:PA26 39 491 8.4e-204 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000208222
AA Change: R118*
Predicted Effect probably benign
Transcript: ENSMUST00000209187
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sestrin family of stress-induced proteins. The encoded protein reduces the levels of intracellular reactive oxygen species induced by activated Ras downstream of RAC-alpha serine/threonine-protein kinase (Akt) and FoxO transcription factor. The protein is required for normal regulation of blood glucose, insulin resistance and plays a role in lipid storage in obesity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2012]
PHENOTYPE: When fed a high fat diet, mice homozygous for a gene trap allele exhibit impaired glucose tolerance, insulin resistance, reduced hepatic glucose production, impaired adipocyte glucose uptake, increased hepatic steatosis, and decreased mitochondria in the liver. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik T G 4: 137,454,579 L15W probably damaging Het
4930550C14Rik G A 9: 53,411,756 V31I possibly damaging Het
4932415D10Rik T C 10: 82,291,899 D1759G possibly damaging Het
Adgre1 C T 17: 57,408,445 S255F probably benign Het
Aff4 T G 11: 53,398,237 S404R probably damaging Het
Akr1c19 A T 13: 4,233,758 probably benign Het
Ankrd31 T A 13: 96,878,249 I1342K probably damaging Het
Arhgap5 T A 12: 52,518,125 D626E possibly damaging Het
Arhgef1 G A 7: 24,916,923 V332I probably benign Het
AY358078 A G 14: 51,826,187 E430G probably damaging Het
B4gat1 T A 19: 5,040,434 I395N probably benign Het
Bub1b T A 2: 118,636,830 I878N probably damaging Het
Ccdc150 C T 1: 54,355,709 Q745* probably null Het
Ccl19 A T 4: 42,754,885 I87N probably damaging Het
Ces2g G C 8: 104,963,908 G107A probably benign Het
Chpt1 A G 10: 88,488,406 V180A probably damaging Het
Col2a1 T C 15: 98,004,454 T14A unknown Het
Dnah7a T C 1: 53,582,625 I1114V possibly damaging Het
Dnah7c T C 1: 46,666,213 I2462T possibly damaging Het
Dnah8 T C 17: 30,643,275 F208S probably damaging Het
Dnhd1 A G 7: 105,714,210 E3993G probably damaging Het
Erv3 C T 2: 131,855,966 D158N possibly damaging Het
Exoc6 T A 19: 37,609,091 F647I probably damaging Het
Fbrs G A 7: 127,479,508 probably benign Het
Fgfr1op2 T C 6: 146,589,965 F109L probably damaging Het
Fv1 T C 4: 147,869,271 F98S possibly damaging Het
Gm436 A G 4: 144,686,325 F15S probably benign Het
H2-M10.1 T C 17: 36,325,592 K107E probably benign Het
Hspg2 A T 4: 137,528,890 Q1436L probably damaging Het
Ighv1-74 T C 12: 115,802,763 Y79C probably damaging Het
Kcnj1 G A 9: 32,396,585 V102I probably benign Het
Mnt C A 11: 74,842,809 probably benign Het
Mrpl15 T C 1: 4,782,660 T112A probably benign Het
Ncdn T C 4: 126,747,189 D506G probably benign Het
Ogdh C T 11: 6,313,806 R81* probably null Het
Olfr791 T A 10: 129,526,673 S149T probably benign Het
Olfr815 G C 10: 129,902,409 F100L probably damaging Het
Pole G T 5: 110,329,583 V1863F probably damaging Het
Pramel5 T C 4: 144,274,007 probably benign Het
Rabep1 A G 11: 70,934,537 K636E probably damaging Het
Rasgrf2 T A 13: 91,885,635 Y1151F probably benign Het
Rrad A G 8: 104,630,636 V93A probably damaging Het
Slc27a3 T C 3: 90,386,290 N596S probably benign Het
Snx19 C A 9: 30,428,935 D456E probably damaging Het
Supt20 T C 3: 54,698,597 S35P probably damaging Het
Syde2 G T 3: 146,019,809 R885L probably benign Het
Synm G A 7: 67,733,658 L1419F probably damaging Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Tekt2 A G 4: 126,323,443 F221L probably benign Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Tmem39b A G 4: 129,693,148 I90T possibly damaging Het
Trib2 A G 12: 15,815,338 S79P probably damaging Het
Usp32 T C 11: 85,010,143 M1084V probably benign Het
Vmn1r181 T C 7: 23,984,847 F246L probably damaging Het
Wnt16 A G 6: 22,288,511 D2G probably damaging Het
Zfp462 A G 4: 55,080,716 E1357G probably benign Het
Zhx3 A G 2: 160,779,868 M793T probably benign Het
Other mutations in Sesn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00970:Sesn3 APN 9 14321142 missense probably damaging 1.00
IGL01396:Sesn3 APN 9 14321078 missense probably benign 0.43
IGL01925:Sesn3 APN 9 14320400 missense probably damaging 1.00
IGL02016:Sesn3 APN 9 14320337 missense probably damaging 1.00
IGL02498:Sesn3 APN 9 14306268 splice site probably benign
IGL02892:Sesn3 APN 9 14314734 critical splice donor site probably null
IGL02933:Sesn3 APN 9 14321208 missense probably damaging 1.00
IGL03112:Sesn3 APN 9 14310261 missense probably damaging 1.00
R0591:Sesn3 UTSW 9 14308558 missense probably damaging 0.96
R1450:Sesn3 UTSW 9 14316224 missense possibly damaging 0.80
R1495:Sesn3 UTSW 9 14308521 missense probably damaging 0.98
R1897:Sesn3 UTSW 9 14308645 missense probably damaging 1.00
R2237:Sesn3 UTSW 9 14308465 missense probably benign
R2238:Sesn3 UTSW 9 14308465 missense probably benign
R4209:Sesn3 UTSW 9 14306209 missense probably benign 0.12
R4352:Sesn3 UTSW 9 14320373 missense probably damaging 0.99
R4535:Sesn3 UTSW 9 14322658 missense probably benign 0.05
R4572:Sesn3 UTSW 9 14321220 missense probably benign 0.03
R6261:Sesn3 UTSW 9 14321163 missense probably benign 0.27
R6304:Sesn3 UTSW 9 14322561 critical splice acceptor site probably null
R6556:Sesn3 UTSW 9 14321253 missense possibly damaging 0.95
R6741:Sesn3 UTSW 9 14320340 missense possibly damaging 0.72
R6906:Sesn3 UTSW 9 14325641 missense probably damaging 0.98
R7289:Sesn3 UTSW 9 14276552 start codon destroyed probably benign
R7318:Sesn3 UTSW 9 14308577 missense probably damaging 0.96
R7646:Sesn3 UTSW 9 14308615 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGAGGCCAGTTCAGGATCTATC -3'
(R):5'- GTGCTCTTTTGTGATCAGCC -3'

Sequencing Primer
(F):5'- GAGGCCAGTTCAGGATCTATCTATAC -3'
(R):5'- CTTTTGTGATCAGCCAGGGCC -3'
Posted On2018-11-28