Incidental Mutation 'R6988:Wnt16'
ID 543077
Institutional Source Beutler Lab
Gene Symbol Wnt16
Ensembl Gene ENSMUSG00000029671
Gene Name wingless-type MMTV integration site family, member 16
Synonyms E130309I19Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6988 (G1)
Quality Score 223.009
Status Not validated
Chromosome 6
Chromosomal Location 22288227-22298522 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 22288511 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 2 (D2G)
Ref Sequence ENSEMBL: ENSMUSP00000135016 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031681] [ENSMUST00000128245] [ENSMUST00000148639]
AlphaFold Q9QYS1
Predicted Effect probably damaging
Transcript: ENSMUST00000031681
AA Change: D2G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000031681
Gene: ENSMUSG00000029671
AA Change: D2G

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
WNT1 48 364 1.13e-146 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000128245
AA Change: D2G

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000134822
Gene: ENSMUSG00000029671
AA Change: D2G

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
WNT1 48 225 1.04e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000148639
AA Change: D2G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000135016
Gene: ENSMUSG00000029671
AA Change: D2G

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
WNT1 48 225 1.61e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176681
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It contains two transcript variants diverging at the 5' termini. These two variants are proposed to be the products of separate promoters and not to be splice variants from a single promoter. They are differentially expressed in normal tissues, one of which (variant 2) is expressed at significant levels only in the pancreas, whereas another one (variant 1) is expressed more ubiquitously with highest levels in adult kidney, placenta, brain, heart, and spleen. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased bone mineral density, cortical bone thickness and bone strength. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik T G 4: 137,454,579 L15W probably damaging Het
4930550C14Rik G A 9: 53,411,756 V31I possibly damaging Het
4932415D10Rik T C 10: 82,291,899 D1759G possibly damaging Het
Adgre1 C T 17: 57,408,445 S255F probably benign Het
Aff4 T G 11: 53,398,237 S404R probably damaging Het
Akr1c19 A T 13: 4,233,758 probably benign Het
Ankrd31 T A 13: 96,878,249 I1342K probably damaging Het
Arhgap5 T A 12: 52,518,125 D626E possibly damaging Het
Arhgef1 G A 7: 24,916,923 V332I probably benign Het
AY358078 A G 14: 51,826,187 E430G probably damaging Het
B4gat1 T A 19: 5,040,434 I395N probably benign Het
Bub1b T A 2: 118,636,830 I878N probably damaging Het
Ccdc150 C T 1: 54,355,709 Q745* probably null Het
Ccl19 A T 4: 42,754,885 I87N probably damaging Het
Ces2g G C 8: 104,963,908 G107A probably benign Het
Chpt1 A G 10: 88,488,406 V180A probably damaging Het
Col2a1 T C 15: 98,004,454 T14A unknown Het
Dnah7a T C 1: 53,582,625 I1114V possibly damaging Het
Dnah7c T C 1: 46,666,213 I2462T possibly damaging Het
Dnah8 T C 17: 30,643,275 F208S probably damaging Het
Dnhd1 A G 7: 105,714,210 E3993G probably damaging Het
Erv3 C T 2: 131,855,966 D158N possibly damaging Het
Exoc6 T A 19: 37,609,091 F647I probably damaging Het
Fbrs G A 7: 127,479,508 probably benign Het
Fgfr1op2 T C 6: 146,589,965 F109L probably damaging Het
Fv1 T C 4: 147,869,271 F98S possibly damaging Het
Gm436 A G 4: 144,686,325 F15S probably benign Het
H2-M10.1 T C 17: 36,325,592 K107E probably benign Het
Hspg2 A T 4: 137,528,890 Q1436L probably damaging Het
Ighv1-74 T C 12: 115,802,763 Y79C probably damaging Het
Kcnj1 G A 9: 32,396,585 V102I probably benign Het
Mnt C A 11: 74,842,809 probably benign Het
Mrpl15 T C 1: 4,782,660 T112A probably benign Het
Ncdn T C 4: 126,747,189 D506G probably benign Het
Ogdh C T 11: 6,313,806 R81* probably null Het
Olfr791 T A 10: 129,526,673 S149T probably benign Het
Olfr815 G C 10: 129,902,409 F100L probably damaging Het
Pole G T 5: 110,329,583 V1863F probably damaging Het
Pramel5 T C 4: 144,274,007 probably benign Het
Rabep1 A G 11: 70,934,537 K636E probably damaging Het
Rasgrf2 T A 13: 91,885,635 Y1151F probably benign Het
Rrad A G 8: 104,630,636 V93A probably damaging Het
Sesn3 A T 9: 14,310,257 R118* probably null Het
Slc27a3 T C 3: 90,386,290 N596S probably benign Het
Snx19 C A 9: 30,428,935 D456E probably damaging Het
Supt20 T C 3: 54,698,597 S35P probably damaging Het
Syde2 G T 3: 146,019,809 R885L probably benign Het
Synm G A 7: 67,733,658 L1419F probably damaging Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Tekt2 A G 4: 126,323,443 F221L probably benign Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Tmem39b A G 4: 129,693,148 I90T possibly damaging Het
Trib2 A G 12: 15,815,338 S79P probably damaging Het
Usp32 T C 11: 85,010,143 M1084V probably benign Het
Vmn1r181 T C 7: 23,984,847 F246L probably damaging Het
Zfp462 A G 4: 55,080,716 E1357G probably benign Het
Zhx3 A G 2: 160,779,868 M793T probably benign Het
Other mutations in Wnt16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Wnt16 APN 6 22291013 missense probably damaging 1.00
IGL01306:Wnt16 APN 6 22297935 missense probably damaging 0.99
IGL02297:Wnt16 APN 6 22297991 nonsense probably null
ANU23:Wnt16 UTSW 6 22297935 missense probably damaging 0.99
R0320:Wnt16 UTSW 6 22297993 missense possibly damaging 0.68
R1671:Wnt16 UTSW 6 22298179 missense probably damaging 1.00
R2342:Wnt16 UTSW 6 22288924 missense probably damaging 1.00
R3437:Wnt16 UTSW 6 22298134 missense probably damaging 0.99
R3786:Wnt16 UTSW 6 22298022 missense probably benign
R5301:Wnt16 UTSW 6 22297849 missense probably damaging 0.99
R5357:Wnt16 UTSW 6 22291232 intron probably benign
R5468:Wnt16 UTSW 6 22291161 missense probably benign 0.00
R5843:Wnt16 UTSW 6 22290948 missense probably damaging 0.99
R6655:Wnt16 UTSW 6 22290966 missense probably damaging 1.00
R6731:Wnt16 UTSW 6 22297892 nonsense probably null
R7437:Wnt16 UTSW 6 22288561 missense probably benign 0.17
R7904:Wnt16 UTSW 6 22297990 missense probably damaging 1.00
R7919:Wnt16 UTSW 6 22291050 missense probably benign 0.01
R7940:Wnt16 UTSW 6 22291189 missense possibly damaging 0.78
R8071:Wnt16 UTSW 6 22288998 missense probably benign
R9057:Wnt16 UTSW 6 22288824 missense probably damaging 1.00
R9195:Wnt16 UTSW 6 22297933 missense probably benign 0.00
Z1177:Wnt16 UTSW 6 22288588 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTTATCTTGCCTAGGGGACTGC -3'
(R):5'- AAGCATTAGGTCAGCGTTCC -3'

Sequencing Primer
(F):5'- CCTAGGGGACTGCTGATAGTC -3'
(R):5'- CATTAGGTCAGCGTTCCTAGGGTC -3'
Posted On 2018-11-28