Incidental Mutation 'R7000:Supt16'
ID 544506
Institutional Source Beutler Lab
Gene Symbol Supt16
Ensembl Gene ENSMUSG00000035726
Gene Name suppressor of Ty 16
Synonyms Supt16h, Spt16, Fact140, Cdc68
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.970) question?
Stock # R7000 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 52160414-52197416 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 52171450 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 822 (S822R)
Ref Sequence ENSEMBL: ENSMUSP00000042283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046709]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000046709
AA Change: S822R

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000042283
Gene: ENSMUSG00000035726
AA Change: S822R

DomainStartEndE-ValueType
FACT-Spt16_Nlob 5 168 2.95e-87 SMART
Pfam:Peptidase_M24 181 411 2.9e-35 PFAM
low complexity region 435 449 N/A INTRINSIC
coiled coil region 462 493 N/A INTRINSIC
SPT16 529 689 3.38e-96 SMART
Rtt106 806 896 1.61e-38 SMART
low complexity region 926 946 N/A INTRINSIC
low complexity region 951 988 N/A INTRINSIC
coiled coil region 994 1023 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transcription of protein-coding genes can be reconstituted on naked DNA with only the general transcription factors and RNA polymerase II. However, this minimal system cannot transcribe DNA packaged into chromatin, indicating that accessory factors may facilitate access to DNA. One such factor, FACT (facilitates chromatin transcription), interacts specifically with histones H2A/H2B to effect nucleosome disassembly and transcription elongation. FACT is composed of an 80 kDa subunit and a 140 kDa subunit; this gene encodes the 140 kDa subunit. [provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a G A 5: 8,702,823 A525T probably benign Het
Abcc6 A G 7: 46,005,522 I515T possibly damaging Het
Abi1 G A 2: 22,942,041 A420V probably damaging Het
Abtb2 A T 2: 103,712,442 I887F possibly damaging Het
Acap3 G A 4: 155,903,849 G602S possibly damaging Het
Auts2 T A 5: 131,440,218 T754S probably benign Het
AW551984 T C 9: 39,600,789 R12G probably benign Het
AW822073 T C 10: 58,222,992 T647A possibly damaging Het
Bcan G A 3: 87,988,379 R817* probably null Het
Bmp10 A G 6: 87,434,193 T323A probably benign Het
Bpnt1 T C 1: 185,349,856 L165P probably damaging Het
Casz1 G A 4: 148,929,236 A86T probably damaging Het
Cd1d2 T C 3: 86,987,773 F189L probably benign Het
Cep72 A G 13: 74,058,325 M126T probably damaging Het
Cep85l T A 10: 53,298,199 T483S probably damaging Het
Cfi C A 3: 129,872,873 T415K probably damaging Het
Chrna7 A G 7: 63,106,039 L253S probably damaging Het
Col4a4 T C 1: 82,497,330 H596R unknown Het
Cyp2j8 A T 4: 96,447,351 M402K probably benign Het
Cyp3a16 T A 5: 145,463,170 probably null Het
Dhdh T C 7: 45,475,274 K332E possibly damaging Het
Dnah11 C A 12: 118,017,661 C2590F probably damaging Het
Dnah17 T C 11: 118,025,702 probably null Het
Dtx1 A G 5: 120,695,083 Y97H probably damaging Het
Elf1 A G 14: 79,570,768 D183G probably damaging Het
Esyt3 A C 9: 99,322,153 L94R probably damaging Het
Exoc3 A G 13: 74,182,166 Y521H probably benign Het
F5 C T 1: 164,179,506 T293M probably damaging Het
Fam118b A T 9: 35,235,264 H102Q probably damaging Het
Flad1 T C 3: 89,402,242 probably benign Het
Flrt3 G A 2: 140,660,884 R275* probably null Het
Fndc7 G A 3: 108,876,648 A215V probably benign Het
Fscn1 T A 5: 142,960,627 V60E probably damaging Het
Gm17175 A T 14: 51,573,961 M1K probably null Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Gprc6a T C 10: 51,615,047 S694G probably benign Het
Iglon5 A T 7: 43,476,830 probably null Het
Iqch T C 9: 63,454,610 T874A probably benign Het
Lamc2 T A 1: 153,166,127 H87L possibly damaging Het
Ldlrad1 T A 4: 107,209,580 D37E probably benign Het
Lman1l G C 9: 57,615,948 Q109E probably benign Het
Loxhd1 T C 18: 77,372,433 probably null Het
Lxn T G 3: 67,462,371 E60D probably benign Het
Man2b2 A G 5: 36,821,869 W276R probably damaging Het
Mast1 T C 8: 84,928,969 Y182C probably damaging Het
Mroh8 C T 2: 157,216,977 R923Q probably benign Het
Nov A T 15: 54,752,347 T303S probably damaging Het
Obscn A G 11: 59,136,038 L113P probably damaging Het
Ocln C T 13: 100,534,962 probably null Het
Olfr1467 A G 19: 13,364,623 probably benign Het
Olfr671 G A 7: 104,975,131 P285S probably damaging Het
Oog2 A T 4: 144,195,327 Q269L probably damaging Het
Osbpl3 A G 6: 50,297,157 S826P probably damaging Het
Otogl T C 10: 107,779,831 N1869S probably benign Het
Pamr1 G A 2: 102,611,623 D186N probably damaging Het
Pcdhga8 T A 18: 37,726,893 I334K probably benign Het
Pde7b A G 10: 20,443,292 S95P probably damaging Het
Pik3cg A T 12: 32,192,129 V994E probably damaging Het
Pkp1 T C 1: 135,889,954 M148V probably benign Het
Plbd1 T G 6: 136,612,838 K461Q probably benign Het
Pmfbp1 A G 8: 109,530,589 E594G possibly damaging Het
Pold3 A T 7: 100,106,658 H60Q probably damaging Het
Polr3gl C T 3: 96,580,467 R52Q possibly damaging Het
Ptgds A G 2: 25,467,816 probably null Het
Scarb2 T C 5: 92,454,075 D320G probably benign Het
Sdk2 T C 11: 113,803,169 Y1812C probably damaging Het
Skint8 C A 4: 111,937,025 T204N probably benign Het
Slc23a2 T C 2: 132,094,203 Q49R possibly damaging Het
Slc26a7 T C 4: 14,552,476 Q227R probably benign Het
Sntn C T 14: 13,679,108 T94I probably damaging Het
Spem2 C T 11: 69,817,756 G128S probably benign Het
Syn3 T C 10: 86,080,252 Y290C probably damaging Het
Tdrd6 C G 17: 43,627,708 E816D probably benign Het
Tln1 A T 4: 43,556,302 M72K probably damaging Het
Tlnrd1 A G 7: 83,882,779 V148A probably damaging Het
Trim24 C A 6: 37,958,678 T832K probably benign Het
Ubr4 C T 4: 139,414,404 A1267V probably damaging Het
Usp17lb A T 7: 104,841,285 M145K probably damaging Het
Vmn1r178 T A 7: 23,894,337 M270K probably benign Het
Vmn2r70 A T 7: 85,559,611 C553S probably damaging Het
Vps37c G T 19: 10,710,329 E51D probably damaging Het
Zfp62 T G 11: 49,216,379 Y432* probably null Het
Other mutations in Supt16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Supt16 APN 14 52161798 missense possibly damaging 0.72
IGL00985:Supt16 APN 14 52161691 missense possibly damaging 0.53
IGL01160:Supt16 APN 14 52183132 missense probably benign
IGL01328:Supt16 APN 14 52177032 missense probably benign 0.20
IGL01329:Supt16 APN 14 52177032 missense probably benign 0.20
IGL01413:Supt16 APN 14 52177032 missense probably benign 0.20
IGL01414:Supt16 APN 14 52177032 missense probably benign 0.20
IGL01535:Supt16 APN 14 52177190 missense probably damaging 0.99
IGL01765:Supt16 APN 14 52180223 missense probably damaging 0.98
IGL01976:Supt16 APN 14 52182307 missense possibly damaging 0.70
IGL02422:Supt16 APN 14 52179543 missense possibly damaging 0.85
IGL02449:Supt16 APN 14 52173806 missense possibly damaging 0.92
IGL02516:Supt16 APN 14 52183964 missense possibly damaging 0.57
IGL02831:Supt16 APN 14 52170878 missense possibly damaging 0.70
IGL03112:Supt16 APN 14 52176398 missense probably damaging 0.98
IGL03406:Supt16 APN 14 52178141 missense possibly damaging 0.92
R7336_Supt16_529 UTSW 14 52171491 missense possibly damaging 0.93
watercolor UTSW 14 52170881 missense probably damaging 0.96
R0332:Supt16 UTSW 14 52181157 missense probably damaging 0.99
R0385:Supt16 UTSW 14 52176718 missense probably benign 0.01
R0389:Supt16 UTSW 14 52174113 missense probably damaging 0.98
R0422:Supt16 UTSW 14 52183996 missense probably benign 0.26
R1101:Supt16 UTSW 14 52171439 missense probably null 0.81
R1212:Supt16 UTSW 14 52174124 nonsense probably null
R1487:Supt16 UTSW 14 52176608 critical splice donor site probably null
R1494:Supt16 UTSW 14 52172459 missense probably benign 0.01
R1566:Supt16 UTSW 14 52176655 missense probably damaging 0.99
R1652:Supt16 UTSW 14 52177180 missense probably benign 0.34
R1913:Supt16 UTSW 14 52178135 missense possibly damaging 0.84
R2220:Supt16 UTSW 14 52172144 nonsense probably null
R2344:Supt16 UTSW 14 52178118 missense probably benign 0.00
R3430:Supt16 UTSW 14 52175359 missense probably benign 0.05
R3746:Supt16 UTSW 14 52180139 missense probably damaging 0.99
R3749:Supt16 UTSW 14 52180139 missense probably damaging 0.99
R4010:Supt16 UTSW 14 52164441 missense probably damaging 1.00
R4108:Supt16 UTSW 14 52162731 missense probably damaging 1.00
R4109:Supt16 UTSW 14 52162731 missense probably damaging 1.00
R4597:Supt16 UTSW 14 52173589 missense probably damaging 1.00
R5117:Supt16 UTSW 14 52183092 missense probably damaging 1.00
R5309:Supt16 UTSW 14 52162698 missense probably damaging 1.00
R5695:Supt16 UTSW 14 52174144 splice site probably null
R5895:Supt16 UTSW 14 52164522 missense probably benign 0.17
R5941:Supt16 UTSW 14 52182196 missense probably benign
R5993:Supt16 UTSW 14 52178334 missense probably damaging 1.00
R6197:Supt16 UTSW 14 52170881 missense probably damaging 0.96
R6254:Supt16 UTSW 14 52170834 missense probably damaging 1.00
R6381:Supt16 UTSW 14 52179546 missense probably benign 0.02
R6667:Supt16 UTSW 14 52172063 missense probably damaging 1.00
R7063:Supt16 UTSW 14 52172048 missense possibly damaging 0.92
R7276:Supt16 UTSW 14 52177001 missense probably benign
R7336:Supt16 UTSW 14 52171491 missense possibly damaging 0.93
R7344:Supt16 UTSW 14 52173571 missense probably damaging 0.98
R7384:Supt16 UTSW 14 52181162 missense probably damaging 0.99
R7411:Supt16 UTSW 14 52178051 missense probably damaging 1.00
R7586:Supt16 UTSW 14 52173556 missense probably damaging 0.97
R7633:Supt16 UTSW 14 52197099 missense probably benign 0.38
R8024:Supt16 UTSW 14 52170875 missense probably damaging 0.96
R8197:Supt16 UTSW 14 52174085 missense possibly damaging 0.95
R8201:Supt16 UTSW 14 52170990 missense probably damaging 1.00
R8285:Supt16 UTSW 14 52181083 missense possibly damaging 0.95
R8508:Supt16 UTSW 14 52181589 missense probably damaging 1.00
R8531:Supt16 UTSW 14 52172563 missense probably damaging 0.98
R8797:Supt16 UTSW 14 52172503 missense probably damaging 0.99
R8872:Supt16 UTSW 14 52174087 missense probably benign 0.01
R9048:Supt16 UTSW 14 52181056 missense probably damaging 1.00
R9743:Supt16 UTSW 14 52171482 missense probably damaging 1.00
Z1177:Supt16 UTSW 14 52163285 missense possibly damaging 0.63
Z1177:Supt16 UTSW 14 52181537 missense probably null 0.21
Predicted Primers PCR Primer
(F):5'- AGGATCCCCTTCTAACAACTGTG -3'
(R):5'- TGCACATACTTAACATGCAGAC -3'

Sequencing Primer
(F):5'- CCCTTCTAACAACTGTGTTACTAAG -3'
(R):5'- CAGTAGGCTTATGTGGCT -3'
Posted On 2019-05-13