Incidental Mutation 'R7025:Nop56'
ID545891
Institutional Source Beutler Lab
Gene Symbol Nop56
Ensembl Gene ENSMUSG00000027405
Gene NameNOP56 ribonucleoprotein
SynonymsNOP56, Nol5a, 2310044F10Rik, 56kDa with KKE/D repeat
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R7025 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location130274430-130279313 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 130277881 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 81 (R81*)
Ref Sequence ENSEMBL: ENSMUSP00000124080 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028890] [ENSMUST00000028892] [ENSMUST00000103198] [ENSMUST00000136621] [ENSMUST00000159373] [ENSMUST00000184538]
Predicted Effect probably null
Transcript: ENSMUST00000028890
AA Change: R114*
SMART Domains Protein: ENSMUSP00000028890
Gene: ENSMUSG00000027405
AA Change: R114*

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Nop 44 127 1.1e-26 PFAM
coiled coil region 131 176 N/A INTRINSIC
low complexity region 185 204 N/A INTRINSIC
low complexity region 213 228 N/A INTRINSIC
low complexity region 242 264 N/A INTRINSIC
low complexity region 280 292 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000028892
SMART Domains Protein: ENSMUSP00000028892
Gene: ENSMUSG00000027406

DomainStartEndE-ValueType
low complexity region 28 40 N/A INTRINSIC
Iso_dh 49 375 1.43e-140 SMART
Predicted Effect probably null
Transcript: ENSMUST00000103198
AA Change: R398*
SMART Domains Protein: ENSMUSP00000099487
Gene: ENSMUSG00000027405
AA Change: R398*

DomainStartEndE-ValueType
Pfam:NOP5NT 5 70 4.3e-20 PFAM
NOSIC 167 219 1.18e-30 SMART
internal_repeat_1 257 305 4.06e-5 PROSPERO
coiled coil region 415 460 N/A INTRINSIC
low complexity region 469 488 N/A INTRINSIC
low complexity region 497 512 N/A INTRINSIC
low complexity region 526 548 N/A INTRINSIC
low complexity region 564 576 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136621
SMART Domains Protein: ENSMUSP00000124616
Gene: ENSMUSG00000027405

DomainStartEndE-ValueType
Pfam:NOP5NT 4 70 3.6e-22 PFAM
NOSIC 167 219 1.18e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141872
SMART Domains Protein: ENSMUSP00000125305
Gene: ENSMUSG00000027405

DomainStartEndE-ValueType
Pfam:NOP5NT 14 79 3.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143547
Predicted Effect probably null
Transcript: ENSMUST00000146454
AA Change: R142*
SMART Domains Protein: ENSMUSP00000125304
Gene: ENSMUSG00000027405
AA Change: R142*

DomainStartEndE-ValueType
Pfam:Nop 1 152 7.8e-66 PFAM
coiled coil region 159 204 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149955
SMART Domains Protein: ENSMUSP00000123879
Gene: ENSMUSG00000027405

DomainStartEndE-ValueType
NOSIC 2 35 1.24e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000150401
AA Change: R93*
SMART Domains Protein: ENSMUSP00000123890
Gene: ENSMUSG00000027405
AA Change: R93*

DomainStartEndE-ValueType
Pfam:Nop 26 103 3.9e-26 PFAM
coiled coil region 110 155 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000159373
AA Change: R81*
SMART Domains Protein: ENSMUSP00000124080
Gene: ENSMUSG00000027405
AA Change: R81*

DomainStartEndE-ValueType
Pfam:Nop 10 94 6e-28 PFAM
coiled coil region 98 135 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184538
SMART Domains Protein: ENSMUSP00000139331
Gene: ENSMUSG00000027406

DomainStartEndE-ValueType
Pfam:Iso_dh 6 71 1.8e-15 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nop56p is a yeast nucleolar protein that is part of a complex with the nucleolar proteins Nop58p and fibrillarin. Nop56p is required for assembly of the 60S ribosomal subunit and is involved in pre-rRNA processing. The protein encoded by this gene is similar in sequence to Nop56p and is also found in the nucleolus. Expansion of a GGCCTG repeat from 3-8 copies to 1500-2500 copies in an intron of this gene results in spinocerebellar ataxia 36. Multiple transcript variants encoding several different isoforms have been found for this gene, but the full-length nature of most of them has not been determined. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd4 T A 11: 103,104,538 L90M probably damaging Het
Acot7 T C 4: 152,178,189 S7P unknown Het
Ahcyl2 T C 6: 29,908,421 Y388H probably damaging Het
Atp1a2 T A 1: 172,284,550 R593* probably null Het
Bicral T C 17: 46,801,668 T869A probably benign Het
Brca2 C T 5: 150,540,478 P1236S probably benign Het
Cacna2d1 C T 5: 16,352,668 Q699* probably null Het
Ccser2 T C 14: 36,940,007 N407D probably damaging Het
Cd300lg A G 11: 102,043,074 Y49C probably damaging Het
Cdh12 C A 15: 21,358,814 T108K probably damaging Het
Ctnnd1 A T 2: 84,610,606 I715K possibly damaging Het
Cyp17a1 T A 19: 46,670,980 D137V probably damaging Het
Dbr1 A G 9: 99,575,983 T19A probably damaging Het
Dnah3 C T 7: 120,030,010 A1441T possibly damaging Het
Dpt G A 1: 164,796,939 D70N probably damaging Het
Elk4 C A 1: 132,019,369 P366Q probably damaging Het
Eml4 A C 17: 83,425,311 D131A probably benign Het
Faap24 A G 7: 35,392,871 I207T possibly damaging Het
Fam198b T C 3: 79,886,548 Y108H probably damaging Het
Fam219a T C 4: 41,521,925 S41G probably benign Het
Gm15448 T A 7: 3,821,262 K629* probably null Het
Ifi203 T C 1: 173,928,385 probably benign Het
Inpp4a T C 1: 37,369,423 V295A probably benign Het
Kif2a A G 13: 106,982,594 Y267H probably damaging Het
Kprp T A 3: 92,825,197 Q182L probably benign Het
Krt90 T C 15: 101,557,175 K337R possibly damaging Het
Lrp2 T A 2: 69,483,028 Y2453F possibly damaging Het
Magel2 A C 7: 62,379,787 Y813S unknown Het
Myh7 C A 14: 54,974,644 E1548* probably null Het
Myh8 A G 11: 67,297,539 T1009A probably benign Het
Nab2 T A 10: 127,666,508 probably benign Het
Neb T C 2: 52,296,273 D929G possibly damaging Het
Nelfb A C 2: 25,210,493 V155G probably damaging Het
Nmur1 C A 1: 86,387,848 M65I possibly damaging Het
Npnt C T 3: 132,908,396 C47Y probably damaging Het
Nrp1 G T 8: 128,480,954 C610F probably damaging Het
Olfr1175-ps T C 2: 88,323,262 K148E probably damaging Het
Olfr1243 T A 2: 89,527,604 I269F probably damaging Het
Olfr766-ps1 T A 10: 129,064,675 M1L probably benign Het
Pax5 G A 4: 44,679,501 Q93* probably null Het
Pcnt G T 10: 76,403,835 Q1273K probably damaging Het
Pde4dip G A 3: 97,724,183 Q1137* probably null Het
Pfas A T 11: 68,990,760 D959E probably benign Het
Prex1 TCCGACCCC TCCGACCCCGACCCC 2: 166,613,187 probably benign Het
Prpf40b C T 15: 99,306,400 Q182* probably null Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Rpe65 A C 3: 159,622,685 E406A probably damaging Het
Serpina3k A T 12: 104,341,142 Y211F probably benign Het
Shkbp1 T C 7: 27,355,281 I65V possibly damaging Het
Slc22a29 G A 19: 8,160,580 P544S probably benign Het
Stab2 T C 10: 86,850,837 D2281G probably damaging Het
Tjp2 A G 19: 24,132,688 M64T probably benign Het
Tnfrsf8 C T 4: 145,274,403 V378I possibly damaging Het
Trpm1 A T 7: 64,226,714 probably null Het
Ubqln3 A G 7: 104,141,275 I536T probably benign Het
Vmn1r44 A G 6: 89,893,754 T161A possibly damaging Het
Vmn2r108 T A 17: 20,471,083 I393F possibly damaging Het
Other mutations in Nop56
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Nop56 APN 2 130275995 missense possibly damaging 0.77
IGL02330:Nop56 APN 2 130276766 missense probably damaging 0.99
IGL02939:Nop56 APN 2 130278197 missense probably damaging 1.00
IGL03149:Nop56 APN 2 130277525 missense probably damaging 1.00
bookish UTSW 2 130276772 missense possibly damaging 0.96
escholar UTSW 2 130277887 missense probably damaging 1.00
scholar UTSW 2 130275982 missense probably damaging 1.00
IGL03046:Nop56 UTSW 2 130275569 unclassified probably benign
R0421:Nop56 UTSW 2 130276772 missense possibly damaging 0.96
R1405:Nop56 UTSW 2 130277948 missense probably benign 0.22
R1405:Nop56 UTSW 2 130277948 missense probably benign 0.22
R1713:Nop56 UTSW 2 130277966 missense possibly damaging 0.85
R2202:Nop56 UTSW 2 130277568 missense probably damaging 1.00
R2203:Nop56 UTSW 2 130277568 missense probably damaging 1.00
R2204:Nop56 UTSW 2 130277568 missense probably damaging 1.00
R3697:Nop56 UTSW 2 130277587 missense probably damaging 1.00
R4114:Nop56 UTSW 2 130276673 splice site probably null
R4679:Nop56 UTSW 2 130278273 missense probably benign 0.36
R4788:Nop56 UTSW 2 130278900 missense probably benign 0.05
R4792:Nop56 UTSW 2 130277864 missense possibly damaging 0.96
R4999:Nop56 UTSW 2 130275725 missense probably benign 0.00
R5889:Nop56 UTSW 2 130275982 missense probably damaging 1.00
R6016:Nop56 UTSW 2 130276625 critical splice donor site probably null
R6389:Nop56 UTSW 2 130277887 missense probably damaging 1.00
R7393:Nop56 UTSW 2 130274638 missense probably benign 0.06
R7867:Nop56 UTSW 2 130278285 missense possibly damaging 0.53
R8026:Nop56 UTSW 2 130277268 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGCAGCTTCTACAATGATGG -3'
(R):5'- AGTCTTGCTGGATCAGGCTC -3'

Sequencing Primer
(F):5'- GGTAATATTTTTCGTCAACAGAGTTC -3'
(R):5'- GCTGGATCAGGCTCATTAAATCAG -3'
Posted On2019-05-13