Incidental Mutation 'R7025:Rpe65'
ID545897
Institutional Source Beutler Lab
Gene Symbol Rpe65
Ensembl Gene ENSMUSG00000028174
Gene Nameretinal pigment epithelium 65
SynonymsA930029L06Rik, Mord1, rd12
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.187) question?
Stock #R7025 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location159599175-159625321 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 159622685 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Alanine at position 406 (E406A)
Ref Sequence ENSEMBL: ENSMUSP00000143654 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029824] [ENSMUST00000196999]
Predicted Effect probably damaging
Transcript: ENSMUST00000029824
AA Change: E406A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029824
Gene: ENSMUSG00000028174
AA Change: E406A

DomainStartEndE-ValueType
Pfam:RPE65 15 532 1.4e-111 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000196999
AA Change: E406A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143654
Gene: ENSMUSG00000028174
AA Change: E406A

DomainStartEndE-ValueType
Pfam:RPE65 15 532 1.4e-111 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is located in the retinal pigment epithelium and is involved in the production of 11-cis retinal and in visual pigment regeneration. There are two forms of this protein, a soluble form called sRPE65, and a palmitoylated, membrane-bound form known as mRPE65. mRPE65 serves as the palmitoyl donor for lecithin retinol acyl transferase (LRAT), the enzyme that catalyzes the vitamin A to all trans retinol step of the chromophore regeneration process. Both mRPE65 and sRPE65 also serve as regulatory proteins, with the ratio and concentrations of these molecules playing a role in the inhibition of 11-cis retinal synthesis. Mutations in this gene have been associated with Leber congenital amaurosis type 2 (LCA2) and retinitis pigmentosa. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit disorganized outer segment discs, reduced rod function, lack of rhodopsin and lipofuscin flurophores, and over-accumulation of all-trans-retinyl esters in the retinal pigment epithelium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd4 T A 11: 103,104,538 L90M probably damaging Het
Acot7 T C 4: 152,178,189 S7P unknown Het
Ahcyl2 T C 6: 29,908,421 Y388H probably damaging Het
Atp1a2 T A 1: 172,284,550 R593* probably null Het
Bicral T C 17: 46,801,668 T869A probably benign Het
Brca2 C T 5: 150,540,478 P1236S probably benign Het
Cacna2d1 C T 5: 16,352,668 Q699* probably null Het
Ccser2 T C 14: 36,940,007 N407D probably damaging Het
Cd300lg A G 11: 102,043,074 Y49C probably damaging Het
Cdh12 C A 15: 21,358,814 T108K probably damaging Het
Ctnnd1 A T 2: 84,610,606 I715K possibly damaging Het
Cyp17a1 T A 19: 46,670,980 D137V probably damaging Het
Dbr1 A G 9: 99,575,983 T19A probably damaging Het
Dnah3 C T 7: 120,030,010 A1441T possibly damaging Het
Dpt G A 1: 164,796,939 D70N probably damaging Het
Elk4 C A 1: 132,019,369 P366Q probably damaging Het
Eml4 A C 17: 83,425,311 D131A probably benign Het
Faap24 A G 7: 35,392,871 I207T possibly damaging Het
Fam198b T C 3: 79,886,548 Y108H probably damaging Het
Fam219a T C 4: 41,521,925 S41G probably benign Het
Gm15448 T A 7: 3,821,262 K629* probably null Het
Ifi203 T C 1: 173,928,385 probably benign Het
Inpp4a T C 1: 37,369,423 V295A probably benign Het
Kif2a A G 13: 106,982,594 Y267H probably damaging Het
Kprp T A 3: 92,825,197 Q182L probably benign Het
Krt90 T C 15: 101,557,175 K337R possibly damaging Het
Lrp2 T A 2: 69,483,028 Y2453F possibly damaging Het
Magel2 A C 7: 62,379,787 Y813S unknown Het
Myh7 C A 14: 54,974,644 E1548* probably null Het
Myh8 A G 11: 67,297,539 T1009A probably benign Het
Nab2 T A 10: 127,666,508 probably benign Het
Neb T C 2: 52,296,273 D929G possibly damaging Het
Nelfb A C 2: 25,210,493 V155G probably damaging Het
Nmur1 C A 1: 86,387,848 M65I possibly damaging Het
Nop56 C T 2: 130,277,881 R81* probably null Het
Npnt C T 3: 132,908,396 C47Y probably damaging Het
Nrp1 G T 8: 128,480,954 C610F probably damaging Het
Olfr1175-ps T C 2: 88,323,262 K148E probably damaging Het
Olfr1243 T A 2: 89,527,604 I269F probably damaging Het
Olfr766-ps1 T A 10: 129,064,675 M1L probably benign Het
Pax5 G A 4: 44,679,501 Q93* probably null Het
Pcnt G T 10: 76,403,835 Q1273K probably damaging Het
Pde4dip G A 3: 97,724,183 Q1137* probably null Het
Pfas A T 11: 68,990,760 D959E probably benign Het
Prex1 TCCGACCCC TCCGACCCCGACCCC 2: 166,613,187 probably benign Het
Prpf40b C T 15: 99,306,400 Q182* probably null Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Serpina3k A T 12: 104,341,142 Y211F probably benign Het
Shkbp1 T C 7: 27,355,281 I65V possibly damaging Het
Slc22a29 G A 19: 8,160,580 P544S probably benign Het
Stab2 T C 10: 86,850,837 D2281G probably damaging Het
Tjp2 A G 19: 24,132,688 M64T probably benign Het
Tnfrsf8 C T 4: 145,274,403 V378I possibly damaging Het
Trpm1 A T 7: 64,226,714 probably null Het
Ubqln3 A G 7: 104,141,275 I536T probably benign Het
Vmn1r44 A G 6: 89,893,754 T161A possibly damaging Het
Vmn2r108 T A 17: 20,471,083 I393F possibly damaging Het
Other mutations in Rpe65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Rpe65 APN 3 159614542 missense probably damaging 0.99
IGL01446:Rpe65 APN 3 159600405 splice site probably benign
IGL01815:Rpe65 APN 3 159604530 splice site probably null
IGL02085:Rpe65 APN 3 159615646 missense probably benign 0.00
IGL02232:Rpe65 APN 3 159604351 missense possibly damaging 0.93
IGL02248:Rpe65 APN 3 159624705 missense probably damaging 1.00
IGL02645:Rpe65 APN 3 159606491 missense probably damaging 0.99
IGL02711:Rpe65 APN 3 159622877 missense possibly damaging 0.84
IGL02982:Rpe65 APN 3 159600361 missense probably damaging 0.99
IGL03280:Rpe65 APN 3 159604341 missense probably damaging 0.96
IGL03350:Rpe65 APN 3 159614517 missense possibly damaging 0.75
IGL03356:Rpe65 APN 3 159615577 missense possibly damaging 0.89
I1329:Rpe65 UTSW 3 159624723 missense probably benign 0.35
R0571:Rpe65 UTSW 3 159600349 missense probably damaging 1.00
R0905:Rpe65 UTSW 3 159601583 missense possibly damaging 0.95
R1024:Rpe65 UTSW 3 159606485 missense probably benign 0.07
R1597:Rpe65 UTSW 3 159614784 missense probably damaging 0.97
R1657:Rpe65 UTSW 3 159614448 missense probably damaging 0.97
R1778:Rpe65 UTSW 3 159622848 missense probably damaging 1.00
R1970:Rpe65 UTSW 3 159615670 missense probably benign
R2259:Rpe65 UTSW 3 159615571 missense probably damaging 1.00
R3012:Rpe65 UTSW 3 159604563 missense possibly damaging 0.61
R3923:Rpe65 UTSW 3 159604400 missense probably benign 0.16
R3975:Rpe65 UTSW 3 159604585 missense probably damaging 1.00
R4204:Rpe65 UTSW 3 159604410 missense probably damaging 0.99
R4825:Rpe65 UTSW 3 159624681 missense probably benign
R4924:Rpe65 UTSW 3 159622631 missense probably benign 0.01
R5269:Rpe65 UTSW 3 159604347 missense probably benign 0.07
R5324:Rpe65 UTSW 3 159604404 missense possibly damaging 0.94
R5441:Rpe65 UTSW 3 159604401 missense probably damaging 1.00
R5854:Rpe65 UTSW 3 159615676 missense probably benign
R5907:Rpe65 UTSW 3 159615682 critical splice donor site probably null
R6149:Rpe65 UTSW 3 159614143 missense probably benign
R6660:Rpe65 UTSW 3 159614708 missense probably damaging 0.98
R6830:Rpe65 UTSW 3 159614168 missense probably benign 0.06
R7092:Rpe65 UTSW 3 159615591 missense probably damaging 1.00
R7203:Rpe65 UTSW 3 159622854 missense probably damaging 0.99
R7366:Rpe65 UTSW 3 159624729 missense probably benign 0.13
R7537:Rpe65 UTSW 3 159604609 missense probably damaging 0.98
R7679:Rpe65 UTSW 3 159604393 missense probably damaging 1.00
R8044:Rpe65 UTSW 3 159614705 missense probably benign
R8179:Rpe65 UTSW 3 159624699 missense probably benign 0.06
R8409:Rpe65 UTSW 3 159614148 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TACAGTAACCAGTCTCCTTGTCTG -3'
(R):5'- ATTCAACCCAAGTCCGTATGC -3'

Sequencing Primer
(F):5'- CCTTAAATGGTGACCTCTGAAAAGAG -3'
(R):5'- CCGTATGCATAAGTATAAGGTTTCCC -3'
Posted On2019-05-13