Incidental Mutation 'PIT4362001:Rnf157'
ID554642
Institutional Source Beutler Lab
Gene Symbol Rnf157
Ensembl Gene ENSMUSG00000052949
Gene Namering finger protein 157
SynonymsA130073L17Rik, 2610036E23Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4362001 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location116336353-116413032 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 116360317 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 127 (D127V)
Ref Sequence ENSEMBL: ENSMUSP00000097776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100202] [ENSMUST00000106398]
Predicted Effect probably damaging
Transcript: ENSMUST00000100202
AA Change: D127V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097776
Gene: ENSMUSG00000052949
AA Change: D127V

DomainStartEndE-ValueType
RING 277 315 5.64e-4 SMART
low complexity region 345 358 N/A INTRINSIC
low complexity region 427 444 N/A INTRINSIC
low complexity region 446 457 N/A INTRINSIC
low complexity region 552 562 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106398
AA Change: D127V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102006
Gene: ENSMUSG00000052949
AA Change: D127V

DomainStartEndE-ValueType
RING 277 315 5.64e-4 SMART
low complexity region 345 358 N/A INTRINSIC
low complexity region 427 444 N/A INTRINSIC
low complexity region 446 457 N/A INTRINSIC
low complexity region 552 562 N/A INTRINSIC
low complexity region 563 574 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149147
SMART Domains Protein: ENSMUSP00000122483
Gene: ENSMUSG00000052949

DomainStartEndE-ValueType
RING 102 140 5.64e-4 SMART
low complexity region 170 183 N/A INTRINSIC
low complexity region 252 269 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 377 387 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.2%
  • 10x: 87.0%
  • 20x: 78.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: The gene supports neuronal survival and dendrite growth and maintenance and knockdown with siRNA induces apoptosis in neuronal tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 T C 17: 31,064,424 S28P possibly damaging Het
Akr1c14 T C 13: 4,079,100 V165A probably damaging Het
Aox2 A T 1: 58,282,680 T44S probably damaging Het
Arhgap29 T A 3: 122,003,212 N482K probably benign Het
Arhgef38 T A 3: 133,160,830 D182V Het
Atad5 C T 11: 80,111,567 H1062Y probably benign Het
Atp6v0b A G 4: 117,885,256 S147P possibly damaging Het
Cblb T A 16: 52,139,542 Y299* probably null Het
Ccdc28b T C 4: 129,621,025 N97S probably benign Het
Cdh23 A G 10: 60,465,458 V479A probably benign Het
Chuk A G 19: 44,098,583 probably null Het
Cmtr2 G A 8: 110,222,336 G426D probably damaging Het
Cog4 G A 8: 110,866,672 D472N probably damaging Het
Creb3 T A 4: 43,565,472 L193* probably null Het
Cxcr6 A T 9: 123,810,461 I183F probably benign Het
Dbf4 A G 5: 8,403,664 F253L probably benign Het
Dcaf8 T C 1: 172,172,797 V174A probably damaging Het
Ddhd2 T C 8: 25,735,752 Y526C probably damaging Het
Dnal4 A G 15: 79,763,565 V33A probably benign Het
Egfl7 C T 2: 26,591,040 P188L probably benign Het
Ephb3 A G 16: 21,220,857 E707G probably damaging Het
Epn3 C T 11: 94,496,523 R7H probably damaging Het
Fam198b C A 3: 79,886,939 S238Y possibly damaging Het
Fbp1 T A 13: 62,867,380 I262F probably damaging Het
Fgfbp3 G A 19: 36,918,688 R177* probably null Het
Gbp5 T C 3: 142,500,710 S52P probably damaging Het
Glb1l2 A T 9: 26,773,981 S282T probably benign Het
Glg1 A T 8: 111,258,799 V133E possibly damaging Het
Gm4787 T G 12: 81,377,175 L736F probably benign Het
Gm5565 A T 5: 146,158,299 S212R probably benign Het
Grin2c T C 11: 115,249,633 T1220A probably benign Het
Grp T G 18: 65,886,226 S133A probably benign Het
Gstp2 C A 19: 4,040,713 D147Y possibly damaging Het
Igkv14-130 T C 6: 67,791,408 F84L probably damaging Het
Inppl1 T C 7: 101,826,013 R944G probably benign Het
Lama2 A T 10: 27,369,136 N216K probably damaging Het
Lrp2 T A 2: 69,537,538 D210V probably damaging Het
Lrrc2 A T 9: 110,962,540 Q120L possibly damaging Het
Lrriq1 A G 10: 103,071,194 I1555T probably benign Het
Map2 G A 1: 66,412,518 G189D probably benign Het
Mdc1 A G 17: 35,844,469 E12G possibly damaging Het
Mdga2 T C 12: 66,797,768 D152G possibly damaging Het
Med23 A G 10: 24,874,571 M99V probably benign Het
Mutyh G A 4: 116,817,070 V273M probably damaging Het
Neurod2 T A 11: 98,327,882 Y152F probably damaging Het
Olfr1002 A C 2: 85,647,724 L199R probably damaging Het
Olfr1177-ps C T 2: 88,344,013 A247T probably benign Het
Olfr898 G T 9: 38,349,198 L32F probably benign Het
Pcdh20 G C 14: 88,467,026 P946R probably damaging Het
Pde6b T C 5: 108,423,585 probably null Het
Pdzrn4 A T 15: 92,769,881 D638V possibly damaging Het
Polr1b A G 2: 129,109,292 D275G possibly damaging Het
Rspo4 T A 2: 151,867,883 C69* probably null Het
Scara3 T C 14: 65,936,402 T63A probably benign Het
Scn2a G A 2: 65,683,838 E289K probably benign Het
Sh3gl2 A G 4: 85,377,549 T163A probably benign Het
Slc2a10 T A 2: 165,516,293 F446Y probably damaging Het
Snapc1 C T 12: 73,982,495 R351C probably damaging Het
Snx6 A G 12: 54,768,030 Y169H possibly damaging Het
Stab2 A T 10: 86,861,435 C1996* probably null Het
Steap4 A G 5: 7,980,337 T398A probably benign Het
Tep1 A T 14: 50,866,053 L260Q probably benign Het
Tspan12 A T 6: 21,835,464 V70D possibly damaging Het
Ttn G A 2: 76,739,018 A27177V probably damaging Het
Ube3a T C 7: 59,276,122 V237A possibly damaging Het
Vil1 G A 1: 74,421,383 R233H probably damaging Het
Xrcc5 A G 1: 72,393,929 T716A probably benign Het
Zbp1 A G 2: 173,216,990 I18T probably damaging Het
Zfp292 A G 4: 34,807,524 V1845A probably benign Het
Zfp407 A T 18: 84,561,268 N573K possibly damaging Het
Zfp64 T C 2: 168,925,815 T626A probably benign Het
Other mutations in Rnf157
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00487:Rnf157 APN 11 116362355 missense probably benign 0.20
IGL01146:Rnf157 APN 11 116350086 missense probably benign 0.00
IGL01955:Rnf157 APN 11 116359896 missense probably damaging 0.96
IGL02010:Rnf157 APN 11 116396226 missense probably damaging 1.00
IGL02194:Rnf157 APN 11 116347032 critical splice donor site probably null
IGL03092:Rnf157 APN 11 116347969 critical splice acceptor site probably null
R0022:Rnf157 UTSW 11 116349450 unclassified probably benign
R0022:Rnf157 UTSW 11 116349450 unclassified probably benign
R0036:Rnf157 UTSW 11 116396302 missense probably damaging 1.00
R0164:Rnf157 UTSW 11 116354810 splice site probably benign
R1476:Rnf157 UTSW 11 116354759 missense probably damaging 1.00
R1509:Rnf157 UTSW 11 116347095 missense probably benign
R1544:Rnf157 UTSW 11 116354362 splice site probably null
R1654:Rnf157 UTSW 11 116358715 missense probably damaging 1.00
R1820:Rnf157 UTSW 11 116354651 missense probably damaging 1.00
R2133:Rnf157 UTSW 11 116358694 missense possibly damaging 0.93
R4017:Rnf157 UTSW 11 116359241 critical splice donor site probably null
R4590:Rnf157 UTSW 11 116359272 missense probably damaging 1.00
R4872:Rnf157 UTSW 11 116355472 missense possibly damaging 0.93
R4891:Rnf157 UTSW 11 116358670 missense probably damaging 1.00
R5608:Rnf157 UTSW 11 116396320 splice site probably null
R5870:Rnf157 UTSW 11 116347074 missense probably benign
R7171:Rnf157 UTSW 11 116362373 missense possibly damaging 0.83
R7376:Rnf157 UTSW 11 116360366 missense probably benign 0.35
R8178:Rnf157 UTSW 11 116347481 missense possibly damaging 0.71
R8356:Rnf157 UTSW 11 116349420 missense probably benign 0.11
X0020:Rnf157 UTSW 11 116360308 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGAAGAGAAAATCTAAATTCAAGGT -3'
(R):5'- CCATGCCAATAGCCACACTG -3'

Sequencing Primer
(F):5'- AGAAAATCTAAATTCAAGGTCCAGAC -3'
(R):5'- GTGCCTCTCTGAGTTCAAGACAAG -3'
Posted On2019-06-07