Mutagenetix > Incidental Mutations

Incidental Mutation 'R7309:Med13'

567455

Institutional Source

Beutler Lab

Gene Symbol

Med13

Ensembl Gene

ENSMUSG00000034297

Gene Name

mediator complex subunit 13

Synonyms

Thrap1, 1110067M05Rik, Trap240

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.952) question?

Stock #

R7309 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

86267033-86357602 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 86291062 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Isoleucine at position 1315 (M1315I)

Ref Sequence

ENSEMBL: ENSMUSP00000044268 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043624]

Predicted Effect

probably benign
Transcript: ENSMUST00000043624
AA Change: M1315I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000044268
Gene: ENSMUSG00000034297
AA Change: M1315I

Domain	Start	End	E-Value	Type
Pfam:Med13_N	1	384	5e-130	PFAM
low complexity region	438	451	N/A	INTRINSIC
low complexity region	531	540	N/A	INTRINSIC
low complexity region	796	814	N/A	INTRINSIC
low complexity region	984	998	N/A	INTRINSIC
low complexity region	1001	1029	N/A	INTRINSIC
low complexity region	1463	1476	N/A	INTRINSIC
low complexity region	1502	1517	N/A	INTRINSIC
low complexity region	1522	1550	N/A	INTRINSIC
low complexity region	1559	1570	N/A	INTRINSIC
low complexity region	1577	1596	N/A	INTRINSIC
Pfam:Med13_C	1637	2161	3.5e-146	PFAM

Meta Mutation Damage Score

0.1100

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

94% (47/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the mediator complex (also known as TRAP, SMCC, DRIP, or ARC), a transcriptional coactivator complex thought to be required for the expression of almost all genes. The mediator complex is recruited by transcriptional activators or nuclear receptors to induce gene expression, possibly by interacting with RNA polymerase II and promoting the formation of a transcriptional pre-initiation complex. The product of this gene is proposed to form a sub-complex with MED12, cyclin C, and CDK8 that can negatively regulate transactivation by mediator. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele exhibited in the heart exhibit increased susceptibility to obesity and worsened glucose intolerance when fed a high fat diet. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522L14Rik	A	C	5: 109,736,953	H346Q	probably damaging	Het
4932414N04Rik	A	T	2: 68,716,186	I71L	probably benign	Het
Anapc1	A	G	2: 128,674,684	S377P	probably damaging	Het
Cldnd2	A	G	7: 43,441,709	T22A	possibly damaging	Het
Comp	A	T	8: 70,373,678		probably null	Het
Cop1	A	G	1: 159,306,625	K446E	probably damaging	Het
Cox18	T	C	5: 90,215,058	T314A	possibly damaging	Het
Csrp3	A	G	7: 48,835,569	V60A	probably benign	Het
Dnah8	A	T	17: 30,875,014	Y4694F	probably damaging	Het
Dnm1l	A	G	16: 16,321,646	Y493H	probably damaging	Het
Esf1	A	T	2: 140,125,091		probably null	Het
Fam187a	T	A	11: 102,886,006	V212E	probably damaging	Het
Fign	A	T	2: 63,979,957	M323K	possibly damaging	Het
Foxf2	A	G	13: 31,626,513	K145R	probably damaging	Het
Fxyd5	T	C	7: 31,035,404	N133D	probably benign	Het
Hnrnpdl	A	T	5: 100,037,623	L240*	probably null	Het
Kcna7	T	G	7: 45,409,255	F322C	probably damaging	Het
Kcnj9	A	G	1: 172,326,258	C100R	probably damaging	Het
Lrrc14b	C	A	13: 74,363,202	C253F	probably benign	Het
Map3k11	T	C	19: 5,690,458	V71A	probably damaging	Het
Mettl24	T	C	10: 40,810,500	V291A	probably benign	Het
Miox	G	T	15: 89,336,049	C148F	probably damaging	Het
Mpdz	A	T	4: 81,381,958		probably null	Het
Mthfsd	G	A	8: 121,108,331		probably benign	Het
Myh15	G	A	16: 49,096,465	A383T	probably benign	Het
Nlrc5	A	G	8: 94,474,042	H117R	probably benign	Het
Ntrk1	A	T	3: 87,795,077	M23K	probably benign	Het
Olfr140	T	A	2: 90,051,457	N289I	probably damaging	Het
Olfr297	T	A	7: 86,527,141	L128H	probably damaging	Het
Olfr935	T	A	9: 38,995,280	S52C	probably damaging	Het
Pkd1l3	A	G	8: 109,648,261		probably null	Het
Plcz1	A	T	6: 140,023,156	D185E	probably damaging	Het
Plekhg5	C	A	4: 152,112,528	Q757K	possibly damaging	Het
Prr23a2	T	A	9: 98,856,974	D128E	probably benign	Het
Rsf1	CGGCGGCGG	CGGCGGCGGGGGCGGCGG	7: 97,579,911		probably benign	Het
Sgsm1	A	T	5: 113,268,846		probably null	Het
Sh3bp5	C	T	14: 31,378,289	V221M	probably benign	Het
Slc25a27	A	T	17: 43,664,192	D59E	probably benign	Het
Slc35e1	G	C	8: 72,492,514	R25G	unknown	Het
Slc4a4	T	C	5: 89,170,751	V626A	probably benign	Het
Slfn5	T	C	11: 82,956,703	L138P	probably damaging	Het
Stat1	A	G	1: 52,126,621		probably null	Het
Tnks2	G	T	19: 36,852,536	A206S	probably damaging	Het
Trav7-1	C	A	14: 52,655,064	Q25K	probably benign	Het
Ttn	A	G	2: 76,898,326	M5470T	unknown	Het
Vps35	A	T	8: 85,274,967	D407E	probably benign	Het
Wdr90	T	C	17: 25,860,702	D190G	probably benign	Het
Wdr93	T	A	7: 79,773,355	F456I	possibly damaging	Het
Wdr95	A	G	5: 149,606,293	E675G	probably benign	Het

Other mutations in Med13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00960:Med13	APN	11	86291040	splice site	probably benign
IGL01391:Med13	APN	11	86328497	missense	probably benign
IGL01767:Med13	APN	11	86319783	missense	probably benign	0.38
IGL01830:Med13	APN	11	86288928	splice site	probably benign
IGL01859:Med13	APN	11	86283751	missense	possibly damaging	0.86
IGL01924:Med13	APN	11	86308696	splice site	probably benign
IGL02080:Med13	APN	11	86283812	missense	probably damaging	0.97
IGL02138:Med13	APN	11	86286765	missense	probably damaging	0.99
IGL02259:Med13	APN	11	86357501	missense	possibly damaging	0.89
IGL02339:Med13	APN	11	86288939	missense	probably benign	0.16
IGL02399:Med13	APN	11	86283945	splice site	probably benign
IGL02646:Med13	APN	11	86283386	missense	probably benign	0.00
IGL03227:Med13	APN	11	86327792	splice site	probably benign
R0116:Med13	UTSW	11	86319897	missense	probably damaging	0.99
R0189:Med13	UTSW	11	86319876	missense	probably benign
R0197:Med13	UTSW	11	86307038	missense	probably benign	0.13
R0206:Med13	UTSW	11	86300856	splice site	probably benign
R0208:Med13	UTSW	11	86300856	splice site	probably benign
R0310:Med13	UTSW	11	86346003	missense	probably benign	0.11
R0360:Med13	UTSW	11	86329161	splice site	probably benign
R0413:Med13	UTSW	11	86299207	splice site	probably benign
R0482:Med13	UTSW	11	86285151	missense	probably benign	0.41
R0497:Med13	UTSW	11	86276983	splice site	probably benign
R0589:Med13	UTSW	11	86283249	missense	probably damaging	1.00
R0601:Med13	UTSW	11	86345962	missense	possibly damaging	0.47
R0646:Med13	UTSW	11	86331089	missense	possibly damaging	0.95
R0701:Med13	UTSW	11	86307038	missense	probably benign	0.13
R0709:Med13	UTSW	11	86319596	missense	possibly damaging	0.95
R0711:Med13	UTSW	11	86301353	splice site	probably benign
R0734:Med13	UTSW	11	86301237	missense	probably benign
R0883:Med13	UTSW	11	86307038	missense	probably benign	0.13
R1793:Med13	UTSW	11	86329351	missense	probably benign	0.45
R1926:Med13	UTSW	11	86289073	missense	possibly damaging	0.47
R1959:Med13	UTSW	11	86298979	missense	probably damaging	1.00
R2286:Med13	UTSW	11	86319689	missense	probably benign	0.05
R2359:Med13	UTSW	11	86291035	splice site	probably benign
R2444:Med13	UTSW	11	86331960	missense	probably damaging	1.00
R2679:Med13	UTSW	11	86298577	missense	probably benign	0.00
R2879:Med13	UTSW	11	86299162	missense	possibly damaging	0.61
R3439:Med13	UTSW	11	86285297	missense	probably damaging	1.00
R3735:Med13	UTSW	11	86279658	missense	probably benign	0.00
R4333:Med13	UTSW	11	86288183	missense	probably benign
R4558:Med13	UTSW	11	86299054	missense	probably damaging	1.00
R4598:Med13	UTSW	11	86278566	missense	probably damaging	0.97
R4773:Med13	UTSW	11	86276920	missense	probably damaging	0.99
R4801:Med13	UTSW	11	86278773	missense	probably damaging	1.00
R4802:Med13	UTSW	11	86278773	missense	probably damaging	1.00
R4806:Med13	UTSW	11	86298577	missense	probably benign	0.00
R4940:Med13	UTSW	11	86288118	missense	probably damaging	1.00
R4974:Med13	UTSW	11	86298847	missense	probably damaging	0.98
R5056:Med13	UTSW	11	86328565	missense	probably benign	0.00
R5133:Med13	UTSW	11	86319849	missense	probably benign	0.32
R5206:Med13	UTSW	11	86319879	missense	probably damaging	1.00
R5352:Med13	UTSW	11	86301468	missense	possibly damaging	0.82
R5534:Med13	UTSW	11	86319365	missense	probably benign	0.09
R5556:Med13	UTSW	11	86327838	missense	probably benign	0.25
R5633:Med13	UTSW	11	86278931	splice site	probably benign
R5769:Med13	UTSW	11	86346003	missense	probably benign	0.11
R6236:Med13	UTSW	11	86328531	missense	probably damaging	0.99
R6479:Med13	UTSW	11	86357527	start gained	probably benign
R6487:Med13	UTSW	11	86331150	missense	probably damaging	1.00
R6524:Med13	UTSW	11	86301467	missense	probably damaging	0.98
R6528:Med13	UTSW	11	86298954	missense	probably damaging	1.00
R6805:Med13	UTSW	11	86278796	missense	possibly damaging	0.48
R6913:Med13	UTSW	11	86319876	missense	probably benign
R7221:Med13	UTSW	11	86288095	missense	probably benign	0.00
R7254:Med13	UTSW	11	86319835	missense	probably benign
R7267:Med13	UTSW	11	86308826	missense	probably benign	0.01
R7404:Med13	UTSW	11	86286446	missense	possibly damaging	0.53
R7586:Med13	UTSW	11	86271002	missense	probably damaging	0.99
R7704:Med13	UTSW	11	86345918	nonsense	probably null
R7922:Med13	UTSW	11	86271005	missense	probably damaging	0.98
R7943:Med13	UTSW	11	86278526	missense	probably damaging	0.97
R8062:Med13	UTSW	11	86319438	missense	probably benign
R8075:Med13	UTSW	11	86272470	missense	probably damaging	0.98
R8207:Med13	UTSW	11	86303549	missense	probably damaging	1.00
Z1176:Med13	UTSW	11	86328544	missense	possibly damaging	0.91
Z1176:Med13	UTSW	11	86345862	missense	probably benign	0.45
Z1176:Med13	UTSW	11	86355423	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTCGTGCTGATGGGAAATTAAAG -3'
(R):5'- AAAGTTTGTGTCACCCAAAAGC -3'

Sequencing Primer
(F):5'- CGTGCTGATGGGAAATTAAAGAACCC -3'
(R):5'- GTTTGTGTCACCCAAAAGCAATGAC -3'

Posted On

2019-06-26