Incidental Mutation 'R6747:Cstf3'
ID530567
Institutional Source Beutler Lab
Gene Symbol Cstf3
Ensembl Gene ENSMUSG00000027176
Gene Namecleavage stimulation factor, 3' pre-RNA, subunit 3
Synonyms4732468G05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R6747 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location104590523-104665429 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 104646767 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 168 (V168F)
Ref Sequence ENSEMBL: ENSMUSP00000028599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028599]
PDB Structure
Crystal Structure of the HAT-C domain of murine CstF-77 [X-RAY DIFFRACTION]
Crystal structure of HAT domain of murine CstF-77 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000028599
AA Change: V168F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000028599
Gene: ENSMUSG00000027176
AA Change: V168F

DomainStartEndE-ValueType
low complexity region 10 27 N/A INTRINSIC
HAT 45 77 4.67e-8 SMART
HAT 79 110 5.04e-4 SMART
HAT 117 152 1.38e-1 SMART
HAT 163 196 4.39e-4 SMART
HAT 229 261 1.19e0 SMART
HAT 271 303 9.12e0 SMART
HAT 319 352 2.73e0 SMART
HAT 354 387 7.31e-1 SMART
HAT 424 456 2.37e0 SMART
HAT 458 494 1.46e0 SMART
low complexity region 597 619 N/A INTRINSIC
Meta Mutation Damage Score 0.2368 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of three (including CSTF1 and CSTF2) cleavage stimulation factors that combine to form the cleavage stimulation factor complex (CSTF). This complex is involved in the polyadenylation and 3' end cleavage of pre-mRNAs. The encoded protein functions as a homodimer and interacts directly with both CSTF1 and CSTF2 in the CSTF complex. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 C T 3: 122,126,313 probably null Het
Acyp1 C T 12: 85,278,905 V107I probably null Het
Aftph T C 11: 20,726,144 probably null Het
Agtpbp1 A T 13: 59,544,353 probably null Het
Arhgap15 C A 2: 44,116,677 P269T probably damaging Het
Arhgap30 T C 1: 171,407,729 V557A probably damaging Het
Asb3 T A 11: 31,081,493 M410K probably benign Het
B4galnt2 T C 11: 95,868,634 probably null Het
Birc3 A G 9: 7,860,261 probably null Het
Cav2 A T 6: 17,286,951 N69Y probably damaging Het
Cc2d2b G A 19: 40,795,667 C826Y probably benign Het
Cenpf T A 1: 189,652,854 T2410S probably benign Het
Chchd1 A G 14: 20,703,380 D24G probably benign Het
Cmip G A 8: 117,436,879 G450S probably benign Het
Col11a1 C T 3: 114,212,450 Q534* probably null Het
Col3a1 G T 1: 45,338,622 probably benign Het
Cox4i1 T C 8: 120,673,230 I31T possibly damaging Het
Dapk1 T C 13: 60,725,340 I352T probably benign Het
Ddx52 T C 11: 83,955,302 V456A probably damaging Het
Dmxl2 A T 9: 54,416,088 H1337Q probably damaging Het
Dnah7a T C 1: 53,636,062 T369A probably benign Het
Dppa1 T A 11: 46,625,595 I8F unknown Het
Ebf1 G T 11: 44,883,814 V213F probably damaging Het
Foxb2 C A 19: 16,872,833 E270* probably null Het
Gclc A T 9: 77,788,245 R450W probably damaging Het
Gm13128 T C 4: 144,332,978 W420R probably benign Het
Grin2d T C 7: 45,862,268 E251G probably damaging Het
Hal A T 10: 93,500,677 N423Y probably damaging Het
Krtap4-8 T A 11: 99,780,091 I185F unknown Het
Lrp3 T A 7: 35,211,437 Q61L probably benign Het
Met A C 6: 17,571,467 Q1296H probably damaging Het
Mphosph9 T A 5: 124,297,699 N557I possibly damaging Het
Mrpl46 C A 7: 78,782,981 W16C probably benign Het
Myh13 G A 11: 67,350,419 R874Q probably damaging Het
Nelfb G A 2: 25,203,381 T453I probably benign Het
Nos2 A G 11: 78,952,954 D909G probably damaging Het
Nr5a2 T C 1: 136,882,344 E431G possibly damaging Het
Nsmce2 A G 15: 59,591,724 D149G probably benign Het
Olfr203 T C 16: 59,303,641 F164L probably benign Het
Olfr690 C T 7: 105,330,027 R55H probably benign Het
Pcbp4 C A 9: 106,460,648 probably null Het
Peg10 A G 6: 4,757,137 probably benign Het
Pms2 C T 5: 143,925,419 P154L probably benign Het
Pou6f2 A C 13: 18,129,187 L112R probably benign Het
Prdm6 A T 18: 53,465,046 probably benign Het
Prob1 G A 18: 35,655,154 R12W probably damaging Het
Rif1 T A 2: 52,078,263 probably null Het
Rpl9-ps6 A G 19: 32,466,143 S137P probably benign Het
Rsf1 GGCG GGCGACGGCAGCG 7: 97,579,906 probably benign Homo
Sec23ip A G 7: 128,752,849 silent Het
Slc38a9 T C 13: 112,690,180 C151R probably benign Het
Slc39a8 T C 3: 135,849,180 probably null Het
Slc6a18 C A 13: 73,677,991 probably benign Het
Snw1 T C 12: 87,464,710 D57G probably damaging Het
Sox6 C G 7: 115,541,731 R505P probably damaging Het
Speg T C 1: 75,410,395 probably null Het
Spire2 C T 8: 123,356,846 R190C probably damaging Het
Stard9 A C 2: 120,698,383 H1707P possibly damaging Het
Tenm3 G T 8: 48,343,243 T237K probably damaging Het
Themis2 T A 4: 132,796,262 E31V possibly damaging Het
Trim56 T G 5: 137,114,521 Q47P probably damaging Het
Trim58 T C 11: 58,651,264 I350T probably benign Het
Ttll7 C T 3: 146,944,056 P639S probably benign Het
Ubxn6 A G 17: 56,070,650 probably null Het
Vmn2r114 A T 17: 23,309,876 F417L probably benign Het
Vmn2r29 T A 7: 7,231,422 M822L probably benign Het
Vps9d1 T C 8: 123,254,007 D27G probably damaging Het
Wdr3 C T 3: 100,138,724 R931Q probably damaging Het
Whamm G A 7: 81,578,302 probably null Het
Zcchc24 T C 14: 25,757,033 H142R probably damaging Het
Zfp292 T C 4: 34,806,894 K2050R probably damaging Het
Other mutations in Cstf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01911:Cstf3 APN 2 104646631 missense probably damaging 1.00
IGL02734:Cstf3 APN 2 104609194 splice site probably benign
IGL03025:Cstf3 APN 2 104608931 missense possibly damaging 0.82
R0043:Cstf3 UTSW 2 104645085 splice site probably benign
R0189:Cstf3 UTSW 2 104652446 missense probably damaging 1.00
R0332:Cstf3 UTSW 2 104646467 critical splice donor site probably null
R0499:Cstf3 UTSW 2 104649605 missense possibly damaging 0.95
R1476:Cstf3 UTSW 2 104648219 missense possibly damaging 0.82
R1677:Cstf3 UTSW 2 104664278 intron probably benign
R1881:Cstf3 UTSW 2 104654218 missense probably benign
R1916:Cstf3 UTSW 2 104655756 missense possibly damaging 0.90
R3720:Cstf3 UTSW 2 104653086 splice site probably benign
R3813:Cstf3 UTSW 2 104609121 missense probably damaging 1.00
R5155:Cstf3 UTSW 2 104652485 missense probably benign
R5304:Cstf3 UTSW 2 104663390 nonsense probably null
R5564:Cstf3 UTSW 2 104609002 intron probably benign
R5869:Cstf3 UTSW 2 104659240 intron probably null
R6172:Cstf3 UTSW 2 104651642 missense probably damaging 1.00
R6841:Cstf3 UTSW 2 104655731 missense probably benign 0.22
R6959:Cstf3 UTSW 2 104649462 missense probably benign
R7139:Cstf3 UTSW 2 104653064 missense possibly damaging 0.87
R7143:Cstf3 UTSW 2 104646616 missense probably benign 0.01
R7350:Cstf3 UTSW 2 104608956 missense probably damaging 1.00
R7794:Cstf3 UTSW 2 104590581 start gained probably benign
X0013:Cstf3 UTSW 2 104659277 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- GCATGGGACTCTGGGTATAC -3'
(R):5'- GCACCTGACACTAGAAGCTC -3'

Sequencing Primer
(F):5'- GACTCTGGGTATACACCTAAAAGTG -3'
(R):5'- TGACACTAGAAGCTCATCTCTG -3'
Posted On2018-08-01