Incidental Mutation 'R6747:Cstf3'
ID 530567
Institutional Source Beutler Lab
Gene Symbol Cstf3
Ensembl Gene ENSMUSG00000027176
Gene Name cleavage stimulation factor, 3' pre-RNA, subunit 3
Synonyms 4732468G05Rik
MMRRC Submission 044864-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.968) question?
Stock # R6747 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 104590523-104665429 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 104646767 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Phenylalanine at position 168 (V168F)
Ref Sequence ENSEMBL: ENSMUSP00000028599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028599]
AlphaFold Q99LI7
PDB Structure Crystal Structure of the HAT-C domain of murine CstF-77 [X-RAY DIFFRACTION]
Crystal structure of HAT domain of murine CstF-77 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000028599
AA Change: V168F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000028599
Gene: ENSMUSG00000027176
AA Change: V168F

DomainStartEndE-ValueType
low complexity region 10 27 N/A INTRINSIC
HAT 45 77 4.67e-8 SMART
HAT 79 110 5.04e-4 SMART
HAT 117 152 1.38e-1 SMART
HAT 163 196 4.39e-4 SMART
HAT 229 261 1.19e0 SMART
HAT 271 303 9.12e0 SMART
HAT 319 352 2.73e0 SMART
HAT 354 387 7.31e-1 SMART
HAT 424 456 2.37e0 SMART
HAT 458 494 1.46e0 SMART
low complexity region 597 619 N/A INTRINSIC
Meta Mutation Damage Score 0.2368 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of three (including CSTF1 and CSTF2) cleavage stimulation factors that combine to form the cleavage stimulation factor complex (CSTF). This complex is involved in the polyadenylation and 3' end cleavage of pre-mRNAs. The encoded protein functions as a homodimer and interacts directly with both CSTF1 and CSTF2 in the CSTF complex. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 C T 3: 122,126,313 (GRCm38) probably null Het
Acyp1 C T 12: 85,278,905 (GRCm38) V107I probably null Het
Aftph T C 11: 20,726,144 (GRCm38) probably null Het
Agtpbp1 A T 13: 59,544,353 (GRCm38) probably null Het
Arhgap15 C A 2: 44,116,677 (GRCm38) P269T probably damaging Het
Arhgap30 T C 1: 171,407,729 (GRCm38) V557A probably damaging Het
Asb3 T A 11: 31,081,493 (GRCm38) M410K probably benign Het
B4galnt2 T C 11: 95,868,634 (GRCm38) probably null Het
Birc3 A G 9: 7,860,261 (GRCm38) probably null Het
Cav2 A T 6: 17,286,951 (GRCm38) N69Y probably damaging Het
Cc2d2b G A 19: 40,795,667 (GRCm38) C826Y probably benign Het
Cenpf T A 1: 189,652,854 (GRCm38) T2410S probably benign Het
Chchd1 A G 14: 20,703,380 (GRCm38) D24G probably benign Het
Cmip G A 8: 117,436,879 (GRCm38) G450S probably benign Het
Col11a1 C T 3: 114,212,450 (GRCm38) Q534* probably null Het
Col3a1 G T 1: 45,338,622 (GRCm38) probably benign Het
Cox4i1 T C 8: 120,673,230 (GRCm38) I31T possibly damaging Het
Dapk1 T C 13: 60,725,340 (GRCm38) I352T probably benign Het
Ddx52 T C 11: 83,955,302 (GRCm38) V456A probably damaging Het
Dmxl2 A T 9: 54,416,088 (GRCm38) H1337Q probably damaging Het
Dnah7a T C 1: 53,636,062 (GRCm38) T369A probably benign Het
Dppa1 T A 11: 46,625,595 (GRCm38) I8F unknown Het
Ebf1 G T 11: 44,883,814 (GRCm38) V213F probably damaging Het
Foxb2 C A 19: 16,872,833 (GRCm38) E270* probably null Het
Gclc A T 9: 77,788,245 (GRCm38) R450W probably damaging Het
Grin2d T C 7: 45,862,268 (GRCm38) E251G probably damaging Het
Hal A T 10: 93,500,677 (GRCm38) N423Y probably damaging Het
Krtap4-8 T A 11: 99,780,091 (GRCm38) I185F unknown Het
Lrp3 T A 7: 35,211,437 (GRCm38) Q61L probably benign Het
Met A C 6: 17,571,467 (GRCm38) Q1296H probably damaging Het
Mphosph9 T A 5: 124,297,699 (GRCm38) N557I possibly damaging Het
Mrpl46 C A 7: 78,782,981 (GRCm38) W16C probably benign Het
Myh13 G A 11: 67,350,419 (GRCm38) R874Q probably damaging Het
Nelfb G A 2: 25,203,381 (GRCm38) T453I probably benign Het
Nos2 A G 11: 78,952,954 (GRCm38) D909G probably damaging Het
Nr5a2 T C 1: 136,882,344 (GRCm38) E431G possibly damaging Het
Nsmce2 A G 15: 59,591,724 (GRCm38) D149G probably benign Het
Or52b1 C T 7: 105,330,027 (GRCm38) R55H probably benign Het
Or5ac21 T C 16: 59,303,641 (GRCm38) F164L probably benign Het
Pcbp4 C A 9: 106,460,648 (GRCm38) probably null Het
Peg10 A G 6: 4,757,137 (GRCm38) probably benign Het
Pms2 C T 5: 143,925,419 (GRCm38) P154L probably benign Het
Pou6f2 A C 13: 18,129,187 (GRCm38) L112R probably benign Het
Pramel30 T C 4: 144,332,978 (GRCm38) W420R probably benign Het
Prdm6 A T 18: 53,465,046 (GRCm38) probably benign Het
Prob1 G A 18: 35,655,154 (GRCm38) R12W probably damaging Het
Rif1 T A 2: 52,078,263 (GRCm38) probably null Het
Rpl9-ps6 A G 19: 32,466,143 (GRCm38) S137P probably benign Het
Rsf1 GGCG GGCGACGGCAGCG 7: 97,579,906 (GRCm38) probably benign Homo
Sec23ip A G 7: 128,752,849 (GRCm38) silent Het
Slc38a9 T C 13: 112,690,180 (GRCm38) C151R probably benign Het
Slc39a8 T C 3: 135,849,180 (GRCm38) probably null Het
Slc6a18 C A 13: 73,677,991 (GRCm38) probably benign Het
Snw1 T C 12: 87,464,710 (GRCm38) D57G probably damaging Het
Sox6 C G 7: 115,541,731 (GRCm38) R505P probably damaging Het
Speg T C 1: 75,410,395 (GRCm38) probably null Het
Spire2 C T 8: 123,356,846 (GRCm38) R190C probably damaging Het
Stard9 A C 2: 120,698,383 (GRCm38) H1707P possibly damaging Het
Tenm3 G T 8: 48,343,243 (GRCm38) T237K probably damaging Het
Themis2 T A 4: 132,796,262 (GRCm38) E31V possibly damaging Het
Trim56 T G 5: 137,114,521 (GRCm38) Q47P probably damaging Het
Trim58 T C 11: 58,651,264 (GRCm38) I350T probably benign Het
Ttll7 C T 3: 146,944,056 (GRCm38) P639S probably benign Het
Ubxn6 A G 17: 56,070,650 (GRCm38) probably null Het
Vmn2r114 A T 17: 23,309,876 (GRCm38) F417L probably benign Het
Vmn2r29 T A 7: 7,231,422 (GRCm38) M822L probably benign Het
Vps9d1 T C 8: 123,254,007 (GRCm38) D27G probably damaging Het
Wdr3 C T 3: 100,138,724 (GRCm38) R931Q probably damaging Het
Whamm G A 7: 81,578,302 (GRCm38) probably null Het
Zcchc24 T C 14: 25,757,033 (GRCm38) H142R probably damaging Het
Zfp292 T C 4: 34,806,894 (GRCm38) K2050R probably damaging Het
Other mutations in Cstf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01911:Cstf3 APN 2 104,646,631 (GRCm38) missense probably damaging 1.00
IGL02734:Cstf3 APN 2 104,609,194 (GRCm38) splice site probably benign
IGL03025:Cstf3 APN 2 104,608,931 (GRCm38) missense possibly damaging 0.82
Amanita UTSW 2 104,590,581 (GRCm38) start gained probably benign
Ptomaine UTSW 2 104,649,462 (GRCm38) missense probably benign
R0043:Cstf3 UTSW 2 104,645,085 (GRCm38) splice site probably benign
R0189:Cstf3 UTSW 2 104,652,446 (GRCm38) missense probably damaging 1.00
R0332:Cstf3 UTSW 2 104,646,467 (GRCm38) critical splice donor site probably null
R0499:Cstf3 UTSW 2 104,649,605 (GRCm38) missense possibly damaging 0.95
R1476:Cstf3 UTSW 2 104,648,219 (GRCm38) missense possibly damaging 0.82
R1677:Cstf3 UTSW 2 104,664,278 (GRCm38) intron probably benign
R1881:Cstf3 UTSW 2 104,654,218 (GRCm38) missense probably benign
R1916:Cstf3 UTSW 2 104,655,756 (GRCm38) missense possibly damaging 0.90
R3720:Cstf3 UTSW 2 104,653,086 (GRCm38) splice site probably benign
R3813:Cstf3 UTSW 2 104,609,121 (GRCm38) missense probably damaging 1.00
R5155:Cstf3 UTSW 2 104,652,485 (GRCm38) missense probably benign
R5304:Cstf3 UTSW 2 104,663,390 (GRCm38) nonsense probably null
R5564:Cstf3 UTSW 2 104,609,002 (GRCm38) intron probably benign
R5869:Cstf3 UTSW 2 104,659,240 (GRCm38) splice site probably null
R6172:Cstf3 UTSW 2 104,651,642 (GRCm38) missense probably damaging 1.00
R6841:Cstf3 UTSW 2 104,655,731 (GRCm38) missense probably benign 0.22
R6959:Cstf3 UTSW 2 104,649,462 (GRCm38) missense probably benign
R7139:Cstf3 UTSW 2 104,653,064 (GRCm38) missense possibly damaging 0.87
R7143:Cstf3 UTSW 2 104,646,616 (GRCm38) missense probably benign 0.01
R7350:Cstf3 UTSW 2 104,608,956 (GRCm38) missense probably damaging 1.00
R7794:Cstf3 UTSW 2 104,590,581 (GRCm38) start gained probably benign
R8315:Cstf3 UTSW 2 104,590,581 (GRCm38) start gained probably benign
R8873:Cstf3 UTSW 2 104,645,010 (GRCm38) missense possibly damaging 0.92
R9188:Cstf3 UTSW 2 104,608,878 (GRCm38) missense possibly damaging 0.68
R9339:Cstf3 UTSW 2 104,663,433 (GRCm38) missense probably damaging 1.00
R9612:Cstf3 UTSW 2 104,653,025 (GRCm38) missense possibly damaging 0.80
R9762:Cstf3 UTSW 2 104,664,339 (GRCm38) nonsense probably null
R9801:Cstf3 UTSW 2 104,590,679 (GRCm38) missense possibly damaging 0.73
X0013:Cstf3 UTSW 2 104,659,277 (GRCm38) missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- GCATGGGACTCTGGGTATAC -3'
(R):5'- GCACCTGACACTAGAAGCTC -3'

Sequencing Primer
(F):5'- GACTCTGGGTATACACCTAAAAGTG -3'
(R):5'- TGACACTAGAAGCTCATCTCTG -3'
Posted On 2018-08-01