Mutagenetix > Incidental Mutations

Incidental Mutation 'R6747:Cstf3'

530567

Institutional Source

Beutler Lab

Gene Symbol

Cstf3

Ensembl Gene

ENSMUSG00000027176

Gene Name

cleavage stimulation factor, 3' pre-RNA, subunit 3

Synonyms

4732468G05Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.966) question?

Stock #

R6747 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

104590523-104665429 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 104646767 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Phenylalanine at position 168 (V168F)

Ref Sequence

ENSEMBL: ENSMUSP00000028599 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028599]

PDB Structure

Crystal Structure of the HAT-C domain of murine CstF-77 [X-RAY DIFFRACTION]
Crystal structure of HAT domain of murine CstF-77 [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000028599
AA Change: V168F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000028599
Gene: ENSMUSG00000027176
AA Change: V168F

Domain	Start	End	E-Value	Type
low complexity region	10	27	N/A	INTRINSIC
HAT	45	77	4.67e-8	SMART
HAT	79	110	5.04e-4	SMART
HAT	117	152	1.38e-1	SMART
HAT	163	196	4.39e-4	SMART
HAT	229	261	1.19e0	SMART
HAT	271	303	9.12e0	SMART
HAT	319	352	2.73e0	SMART
HAT	354	387	7.31e-1	SMART
HAT	424	456	2.37e0	SMART
HAT	458	494	1.46e0	SMART
low complexity region	597	619	N/A	INTRINSIC

Meta Mutation Damage Score

0.2368

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 96.0%

Validation Efficiency

97% (68/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of three (including CSTF1 and CSTF2) cleavage stimulation factors that combine to form the cleavage stimulation factor complex (CSTF). This complex is involved in the polyadenylation and 3' end cleavage of pre-mRNAs. The encoded protein functions as a homodimer and interacts directly with both CSTF1 and CSTF2 in the CSTF complex. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	C	T	3: 122,126,313		probably null	Het
Acyp1	C	T	12: 85,278,905	V107I	probably null	Het
Aftph	T	C	11: 20,726,144		probably null	Het
Agtpbp1	A	T	13: 59,544,353		probably null	Het
Arhgap15	C	A	2: 44,116,677	P269T	probably damaging	Het
Arhgap30	T	C	1: 171,407,729	V557A	probably damaging	Het
Asb3	T	A	11: 31,081,493	M410K	probably benign	Het
B4galnt2	T	C	11: 95,868,634		probably null	Het
Birc3	A	G	9: 7,860,261		probably null	Het
Cav2	A	T	6: 17,286,951	N69Y	probably damaging	Het
Cc2d2b	G	A	19: 40,795,667	C826Y	probably benign	Het
Cenpf	T	A	1: 189,652,854	T2410S	probably benign	Het
Chchd1	A	G	14: 20,703,380	D24G	probably benign	Het
Cmip	G	A	8: 117,436,879	G450S	probably benign	Het
Col11a1	C	T	3: 114,212,450	Q534*	probably null	Het
Col3a1	G	T	1: 45,338,622		probably benign	Het
Cox4i1	T	C	8: 120,673,230	I31T	possibly damaging	Het
Dapk1	T	C	13: 60,725,340	I352T	probably benign	Het
Ddx52	T	C	11: 83,955,302	V456A	probably damaging	Het
Dmxl2	A	T	9: 54,416,088	H1337Q	probably damaging	Het
Dnah7a	T	C	1: 53,636,062	T369A	probably benign	Het
Dppa1	T	A	11: 46,625,595	I8F	unknown	Het
Ebf1	G	T	11: 44,883,814	V213F	probably damaging	Het
Foxb2	C	A	19: 16,872,833	E270*	probably null	Het
Gclc	A	T	9: 77,788,245	R450W	probably damaging	Het
Gm13128	T	C	4: 144,332,978	W420R	probably benign	Het
Grin2d	T	C	7: 45,862,268	E251G	probably damaging	Het
Hal	A	T	10: 93,500,677	N423Y	probably damaging	Het
Krtap4-8	T	A	11: 99,780,091	I185F	unknown	Het
Lrp3	T	A	7: 35,211,437	Q61L	probably benign	Het
Met	A	C	6: 17,571,467	Q1296H	probably damaging	Het
Mphosph9	T	A	5: 124,297,699	N557I	possibly damaging	Het
Mrpl46	C	A	7: 78,782,981	W16C	probably benign	Het
Myh13	G	A	11: 67,350,419	R874Q	probably damaging	Het
Nelfb	G	A	2: 25,203,381	T453I	probably benign	Het
Nos2	A	G	11: 78,952,954	D909G	probably damaging	Het
Nr5a2	T	C	1: 136,882,344	E431G	possibly damaging	Het
Nsmce2	A	G	15: 59,591,724	D149G	probably benign	Het
Olfr203	T	C	16: 59,303,641	F164L	probably benign	Het
Olfr690	C	T	7: 105,330,027	R55H	probably benign	Het
Pcbp4	C	A	9: 106,460,648		probably null	Het
Peg10	A	G	6: 4,757,137		probably benign	Het
Pms2	C	T	5: 143,925,419	P154L	probably benign	Het
Pou6f2	A	C	13: 18,129,187	L112R	probably benign	Het
Prdm6	A	T	18: 53,465,046		probably benign	Het
Prob1	G	A	18: 35,655,154	R12W	probably damaging	Het
Rif1	T	A	2: 52,078,263		probably null	Het
Rpl9-ps6	A	G	19: 32,466,143	S137P	probably benign	Het
Rsf1	GGCG	GGCGACGGCAGCG	7: 97,579,906		probably benign	Homo
Sec23ip	A	G	7: 128,752,849		silent	Het
Slc38a9	T	C	13: 112,690,180	C151R	probably benign	Het
Slc39a8	T	C	3: 135,849,180		probably null	Het
Slc6a18	C	A	13: 73,677,991		probably benign	Het
Snw1	T	C	12: 87,464,710	D57G	probably damaging	Het
Sox6	C	G	7: 115,541,731	R505P	probably damaging	Het
Speg	T	C	1: 75,410,395		probably null	Het
Spire2	C	T	8: 123,356,846	R190C	probably damaging	Het
Stard9	A	C	2: 120,698,383	H1707P	possibly damaging	Het
Tenm3	G	T	8: 48,343,243	T237K	probably damaging	Het
Themis2	T	A	4: 132,796,262	E31V	possibly damaging	Het
Trim56	T	G	5: 137,114,521	Q47P	probably damaging	Het
Trim58	T	C	11: 58,651,264	I350T	probably benign	Het
Ttll7	C	T	3: 146,944,056	P639S	probably benign	Het
Ubxn6	A	G	17: 56,070,650		probably null	Het
Vmn2r114	A	T	17: 23,309,876	F417L	probably benign	Het
Vmn2r29	T	A	7: 7,231,422	M822L	probably benign	Het
Vps9d1	T	C	8: 123,254,007	D27G	probably damaging	Het
Wdr3	C	T	3: 100,138,724	R931Q	probably damaging	Het
Whamm	G	A	7: 81,578,302		probably null	Het
Zcchc24	T	C	14: 25,757,033	H142R	probably damaging	Het
Zfp292	T	C	4: 34,806,894	K2050R	probably damaging	Het

Other mutations in Cstf3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01911:Cstf3	APN	2	104646631	missense	probably damaging	1.00
IGL02734:Cstf3	APN	2	104609194	splice site	probably benign
IGL03025:Cstf3	APN	2	104608931	missense	possibly damaging	0.82
Amanita	UTSW	2	104590581	start gained	probably benign
Ptomaine	UTSW	2	104649462	missense	probably benign
R0043:Cstf3	UTSW	2	104645085	splice site	probably benign
R0189:Cstf3	UTSW	2	104652446	missense	probably damaging	1.00
R0332:Cstf3	UTSW	2	104646467	critical splice donor site	probably null
R0499:Cstf3	UTSW	2	104649605	missense	possibly damaging	0.95
R1476:Cstf3	UTSW	2	104648219	missense	possibly damaging	0.82
R1677:Cstf3	UTSW	2	104664278	intron	probably benign
R1881:Cstf3	UTSW	2	104654218	missense	probably benign
R1916:Cstf3	UTSW	2	104655756	missense	possibly damaging	0.90
R3720:Cstf3	UTSW	2	104653086	splice site	probably benign
R3813:Cstf3	UTSW	2	104609121	missense	probably damaging	1.00
R5155:Cstf3	UTSW	2	104652485	missense	probably benign
R5304:Cstf3	UTSW	2	104663390	nonsense	probably null
R5564:Cstf3	UTSW	2	104609002	intron	probably benign
R5869:Cstf3	UTSW	2	104659240	splice site	probably null
R6172:Cstf3	UTSW	2	104651642	missense	probably damaging	1.00
R6841:Cstf3	UTSW	2	104655731	missense	probably benign	0.22
R6959:Cstf3	UTSW	2	104649462	missense	probably benign
R7139:Cstf3	UTSW	2	104653064	missense	possibly damaging	0.87
R7143:Cstf3	UTSW	2	104646616	missense	probably benign	0.01
R7350:Cstf3	UTSW	2	104608956	missense	probably damaging	1.00
R7794:Cstf3	UTSW	2	104590581	start gained	probably benign
R8315:Cstf3	UTSW	2	104590581	start gained	probably benign
X0013:Cstf3	UTSW	2	104659277	missense	possibly damaging	0.58

Predicted Primers

PCR Primer
(F):5'- GCATGGGACTCTGGGTATAC -3'
(R):5'- GCACCTGACACTAGAAGCTC -3'

Sequencing Primer
(F):5'- GACTCTGGGTATACACCTAAAAGTG -3'
(R):5'- TGACACTAGAAGCTCATCTCTG -3'

Posted On

2018-08-01