Incidental Mutation 'R7411:Klk6'
ID575077
Institutional Source Beutler Lab
Gene Symbol Klk6
Ensembl Gene ENSMUSG00000050063
Gene Namekallikrein related-peptidase 6
SynonymsBssp, Klk29, neurosin, protease M, Prss18, Prss9
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7411 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location43824499-43832030 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43826943 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 69 (H69R)
Ref Sequence ENSEMBL: ENSMUSP00000103600 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107966] [ENSMUST00000107967] [ENSMUST00000107968] [ENSMUST00000177514]
Predicted Effect probably damaging
Transcript: ENSMUST00000107966
AA Change: H69R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103600
Gene: ENSMUSG00000050063
AA Change: H69R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Tryp_SPc 28 244 3.1e-89 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107967
AA Change: H69R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103601
Gene: ENSMUSG00000050063
AA Change: H69R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Tryp_SPc 28 244 3.1e-89 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107968
AA Change: H69R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103602
Gene: ENSMUSG00000050063
AA Change: H69R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Tryp_SPc 28 244 3.1e-89 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000177514
AA Change: H69R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135591
Gene: ENSMUSG00000050063
AA Change: H69R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Tryp_SPc 28 129 5.07e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kallikrein subfamily of the peptidase S1 family of serine proteases. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. The encoded preproprotein is proteolytically processed to generate the mature protease. Expression of this protease is regulated by steroid hormones and may be elevated in multiple human cancers and in serum from psoriasis patients. The encoded protease may participate in the cleavage of amyloid precursor protein and alpha-synuclein, thus implicating this protease in Alzheimer's and Parkinson's disease, respectively. This gene is located in a gene cluster on chromosome 19. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased mature oligodendrocytes in the developing spinal cord. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik C T 19: 3,717,241 T276I possibly damaging Het
9130011E15Rik A C 19: 45,965,435 V170G probably benign Het
Abca17 A G 17: 24,328,569 I277T possibly damaging Het
Abcb11 C T 2: 69,303,936 probably null Het
Abcc12 C A 8: 86,560,850 R122L possibly damaging Het
Abcc8 A G 7: 46,165,917 probably null Het
Adam28 C T 14: 68,626,947 R469K probably damaging Het
Adamts18 T C 8: 113,777,730 Y243C probably damaging Het
Agbl3 T C 6: 34,814,819 S619P probably damaging Het
Alpk3 A T 7: 81,092,852 T806S probably benign Het
Atoh1 T A 6: 64,729,930 I203N probably damaging Het
Cables1 A G 18: 11,840,515 E237G probably benign Het
Cacna1d A G 14: 30,352,990 M1T probably null Het
Ccdc91 C T 6: 147,592,198 Q363* probably null Het
Ceacam5 T A 7: 17,750,753 D473E probably damaging Het
Cfap54 T A 10: 92,868,755 D2821V unknown Het
Clca3a2 A G 3: 144,802,099 S737P probably damaging Het
Clec4n T A 6: 123,232,186 M70K probably benign Het
Dstyk G A 1: 132,417,666 G21S probably benign Het
Enpp5 A G 17: 44,081,475 D265G probably damaging Het
Gabrb1 T C 5: 72,122,195 probably null Het
Gm11639 T G 11: 104,999,723 N4210K probably benign Het
Gm28710 A T 5: 16,824,765 T500S possibly damaging Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Gm5861 T A 5: 11,183,149 probably null Het
Gm9513 T C 9: 36,475,684 V16A possibly damaging Het
Guk1 A G 11: 59,185,985 F91L Het
Ints1 C T 5: 139,764,260 E961K possibly damaging Het
Irx2 T A 13: 72,629,063 M1K probably null Het
Jrk C T 15: 74,707,199 R79H possibly damaging Het
Kcnu1 G T 8: 25,892,088 V489L probably damaging Het
Kctd7 C T 5: 130,152,424 T209M probably benign Het
Kdm5a T A 6: 120,426,815 V1127E probably damaging Het
Lck T C 4: 129,551,970 K340R probably benign Het
Lrrc75a A G 11: 62,605,908 L276P probably damaging Het
Med25 A G 7: 44,878,243 W730R probably damaging Het
Muc4 T C 16: 32,751,322 V400A probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Myt1 C A 2: 181,815,106 H906Q probably damaging Het
Ncl A T 1: 86,350,842 F673I probably damaging Het
Nfe2l1 G T 11: 96,822,183 T216N probably benign Het
Nos2 G A 11: 78,944,855 probably null Het
Nphp4 T A 4: 152,554,717 I935N probably benign Het
Ntn1 G A 11: 68,386,089 A11V probably benign Het
Olfr1257 T C 2: 89,881,261 V145A probably damaging Het
Olfr1395 A T 11: 49,148,994 M246L probably benign Het
Pcdha12 A G 18: 37,021,608 Y460C probably damaging Het
Pcdha4 G T 18: 36,953,058 R98L probably benign Het
Pitpnc1 A G 11: 107,212,572 S234P probably damaging Het
Pmfbp1 A T 8: 109,513,871 Y195F probably damaging Het
Prl6a1 T C 13: 27,318,142 I164T probably damaging Het
Ptpn18 G A 1: 34,472,192 probably null Het
Rhbdl2 G A 4: 123,829,642 A280T possibly damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,579,932 probably benign Het
Sema3a T G 5: 13,516,263 Y171* probably null Het
Set A G 2: 30,066,885 E22G probably benign Het
Sirpb1b A T 3: 15,542,997 D229E probably benign Het
Slc12a2 A T 18: 57,941,013 I1096F probably benign Het
Slc30a5 T C 13: 100,818,180 I159V probably benign Het
Slc35f3 CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 8: 126,389,038 unknown Het
Slc6a20b A G 9: 123,604,948 I275T probably benign Het
Stradb A C 1: 58,988,518 D69A possibly damaging Het
Supt16 A T 14: 52,178,051 V409E probably damaging Het
Tcea2 A G 2: 181,686,664 N195S probably damaging Het
Thumpd3 T C 6: 113,056,111 V270A possibly damaging Het
Urgcp T A 11: 5,718,116 H117L probably benign Het
Vps13c T A 9: 67,972,001 M3408K probably damaging Het
Wdfy4 A C 14: 33,106,131 M1078R Het
Wdr63 A G 3: 146,097,145 V97A probably damaging Het
Ypel5 G A 17: 72,846,444 probably null Het
Other mutations in Klk6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02691:Klk6 APN 7 43828500 missense probably benign 0.03
R0382:Klk6 UTSW 7 43829245 missense probably benign 0.03
R0453:Klk6 UTSW 7 43828539 missense probably damaging 1.00
R1479:Klk6 UTSW 7 43831634 missense probably benign 0.03
R1521:Klk6 UTSW 7 43829275 critical splice donor site probably null
R1772:Klk6 UTSW 7 43829271 nonsense probably null
R1902:Klk6 UTSW 7 43826057 start codon destroyed probably benign 0.03
R4238:Klk6 UTSW 7 43829173 missense probably benign 0.02
R4239:Klk6 UTSW 7 43829173 missense probably benign 0.02
R4240:Klk6 UTSW 7 43829173 missense probably benign 0.02
R5182:Klk6 UTSW 7 43828660 missense probably benign 0.16
R5274:Klk6 UTSW 7 43829129 splice site probably null
R6776:Klk6 UTSW 7 43826874 missense probably damaging 1.00
R7702:Klk6 UTSW 7 43829265 missense probably damaging 0.98
R8035:Klk6 UTSW 7 43828662 missense probably benign 0.00
Z1088:Klk6 UTSW 7 43828488 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GGGACCCATTTGATTACAGTTC -3'
(R):5'- TTTAAGGGCTTGAGATACCTTCAG -3'

Sequencing Primer
(F):5'- CAGTTCATTTCAGAAGGATCTAGGC -3'
(R):5'- GGGTCCCGGAACCTATGGATAC -3'
Posted On2019-10-07