Mutagenetix > Incidental Mutation

Incidental Mutation 'R7411:Agbl3'

575070

Institutional Source

Beutler Lab

Gene Symbol

Agbl3

Ensembl Gene

ENSMUSG00000038836

Gene Name

ATP/GTP binding protein-like 3

Synonyms

4930431N21Rik, 2900053G10Rik, 6530406M24Rik

MMRRC Submission

045492-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7411 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

34780432-34859459 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 34814819 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 619 (S619P)

Ref Sequence

ENSEMBL: ENSMUSP00000110668 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115016] [ENSMUST00000115017] [ENSMUST00000148834]

AlphaFold

Q8CDP0

Predicted Effect

probably damaging
Transcript: ENSMUST00000115016
AA Change: S619P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000110668
Gene: ENSMUSG00000038836
AA Change: S619P

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC
Pfam:Peptidase_M14	314	563	2.7e-19	PFAM
low complexity region	614	629	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000115017
AA Change: S614P

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000110669
Gene: ENSMUSG00000038836
AA Change: S614P

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC
Pfam:Peptidase_M14	309	560	1e-33	PFAM
low complexity region	609	624	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000148834

SMART Domains

Protein: ENSMUSP00000116066
Gene: ENSMUSG00000038836

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous mice for a targeted allele are viable and fertile. Mice homozygous for a knock-out allele exhibit normal response to herpes simplex virus (HSV) and vaccinia virus (VACV) infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810055G02Rik	C	T	19: 3,717,241	T276I	possibly damaging	Het
9130011E15Rik	A	C	19: 45,965,435	V170G	probably benign	Het
Abca17	A	G	17: 24,328,569	I277T	possibly damaging	Het
Abcb11	C	T	2: 69,303,936		probably null	Het
Abcc12	C	A	8: 86,560,850	R122L	possibly damaging	Het
Abcc8	A	G	7: 46,165,917		probably null	Het
Adam28	C	T	14: 68,626,947	R469K	probably damaging	Het
Adamts18	T	C	8: 113,777,730	Y243C	probably damaging	Het
Alpk3	A	T	7: 81,092,852	T806S	probably benign	Het
Atoh1	T	A	6: 64,729,930	I203N	probably damaging	Het
Cables1	A	G	18: 11,840,515	E237G	probably benign	Het
Cacna1d	A	G	14: 30,352,990	M1T	probably null	Het
Ccdc91	C	T	6: 147,592,198	Q363*	probably null	Het
Ceacam5	T	A	7: 17,750,753	D473E	probably damaging	Het
Cfap54	T	A	10: 92,868,755	D2821V	unknown	Het
Clca3a2	A	G	3: 144,802,099	S737P	probably damaging	Het
Clec4n	T	A	6: 123,232,186	M70K	probably benign	Het
Dstyk	G	A	1: 132,417,666	G21S	probably benign	Het
Enpp5	A	G	17: 44,081,475	D265G	probably damaging	Het
Gabrb1	T	C	5: 72,122,195		probably null	Het
Gm11639	T	G	11: 104,999,723	N4210K	probably benign	Het
Gm28710	A	T	5: 16,824,765	T500S	possibly damaging	Het
Gm40460	CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG	CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG	7: 142,240,817		probably benign	Het
Gm5861	T	A	5: 11,183,149		probably null	Het
Gm9513	T	C	9: 36,475,684	V16A	possibly damaging	Het
Guk1	A	G	11: 59,185,985	F91L		Het
Ints1	C	T	5: 139,764,260	E961K	possibly damaging	Het
Irx2	T	A	13: 72,629,063	M1K	probably null	Het
Jrk	C	T	15: 74,707,199	R79H	possibly damaging	Het
Kcnu1	G	T	8: 25,892,088	V489L	probably damaging	Het
Kctd7	C	T	5: 130,152,424	T209M	probably benign	Het
Kdm5a	T	A	6: 120,426,815	V1127E	probably damaging	Het
Klk6	A	G	7: 43,826,943	H69R	probably damaging	Het
Lck	T	C	4: 129,551,970	K340R	probably benign	Het
Lrrc75a	A	G	11: 62,605,908	L276P	probably damaging	Het
Med25	A	G	7: 44,878,243	W730R	probably damaging	Het
Muc4	T	C	16: 32,751,322	V400A	probably benign	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Myt1	C	A	2: 181,815,106	H906Q	probably damaging	Het
Ncl	A	T	1: 86,350,842	F673I	probably damaging	Het
Nfe2l1	G	T	11: 96,822,183	T216N	probably benign	Het
Nos2	G	A	11: 78,944,855		probably null	Het
Nphp4	T	A	4: 152,554,717	I935N	probably benign	Het
Ntn1	G	A	11: 68,386,089	A11V	probably benign	Het
Olfr1257	T	C	2: 89,881,261	V145A	probably damaging	Het
Olfr1395	A	T	11: 49,148,994	M246L	probably benign	Het
Pcdha12	A	G	18: 37,021,608	Y460C	probably damaging	Het
Pcdha4	G	T	18: 36,953,058	R98L	probably benign	Het
Pitpnc1	A	G	11: 107,212,572	S234P	probably damaging	Het
Pmfbp1	A	T	8: 109,513,871	Y195F	probably damaging	Het
Prl6a1	T	C	13: 27,318,142	I164T	probably damaging	Het
Ptpn18	G	A	1: 34,472,192		probably null	Het
Rhbdl2	G	A	4: 123,829,642	A280T	possibly damaging	Het
Rsf1	CGGC	CGGCGGCGGGGGC	7: 97,579,932		probably benign	Het
Sema3a	T	G	5: 13,516,263	Y171*	probably null	Het
Set	A	G	2: 30,066,885	E22G	probably benign	Het
Sirpb1b	A	T	3: 15,542,997	D229E	probably benign	Het
Slc12a2	A	T	18: 57,941,013	I1096F	probably benign	Het
Slc30a5	T	C	13: 100,818,180	I159V	probably benign	Het
Slc35f3	CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	8: 126,389,038		probably benign	Het
Slc6a20b	A	G	9: 123,604,948	I275T	probably benign	Het
Stradb	A	C	1: 58,988,518	D69A	possibly damaging	Het
Supt16	A	T	14: 52,178,051	V409E	probably damaging	Het
Tcea2	A	G	2: 181,686,664	N195S	probably damaging	Het
Thumpd3	T	C	6: 113,056,111	V270A	possibly damaging	Het
Urgcp	T	A	11: 5,718,116	H117L	probably benign	Het
Vps13c	T	A	9: 67,972,001	M3408K	probably damaging	Het
Wdfy4	A	C	14: 33,106,131	M1078R		Het
Wdr63	A	G	3: 146,097,145	V97A	probably damaging	Het
Ypel5	G	A	17: 72,846,444		probably null	Het

Other mutations in Agbl3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Agbl3	APN	6	34846836	missense	probably damaging	1.00
IGL00835:Agbl3	APN	6	34799732	missense	probably damaging	1.00
IGL00840:Agbl3	APN	6	34799159	missense	possibly damaging	0.95
IGL01090:Agbl3	APN	6	34799887	missense	probably benign	0.40
IGL01123:Agbl3	APN	6	34846976	nonsense	probably null
IGL01707:Agbl3	APN	6	34839454	missense	possibly damaging	0.78
IGL01728:Agbl3	APN	6	34782157	start codon destroyed	probably null
IGL02335:Agbl3	APN	6	34799750	missense	probably damaging	1.00
IGL02420:Agbl3	APN	6	34785307	missense	possibly damaging	0.47
IGL02551:Agbl3	APN	6	34823071	missense	possibly damaging	0.88
IGL02974:Agbl3	APN	6	34799822	missense	probably damaging	1.00
IGL03167:Agbl3	APN	6	34857659	missense	possibly damaging	0.92
IGL03182:Agbl3	APN	6	34803500	missense	probably damaging	1.00
R0044:Agbl3	UTSW	6	34799899	missense	probably damaging	1.00
R0499:Agbl3	UTSW	6	34839335	missense	probably benign
R0639:Agbl3	UTSW	6	34799705	missense	probably damaging	1.00
R0850:Agbl3	UTSW	6	34799204	missense	probably damaging	1.00
R1004:Agbl3	UTSW	6	34803451	missense	probably damaging	0.99
R1080:Agbl3	UTSW	6	34828235	missense	probably benign	0.14
R1589:Agbl3	UTSW	6	34857517	missense	possibly damaging	0.77
R2361:Agbl3	UTSW	6	34832505	missense	possibly damaging	0.87
R2495:Agbl3	UTSW	6	34846764	missense	probably damaging	1.00
R3236:Agbl3	UTSW	6	34823087	splice site	probably null
R3237:Agbl3	UTSW	6	34823087	splice site	probably null
R3420:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3421:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3422:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3810:Agbl3	UTSW	6	34799729	missense	probably damaging	1.00
R3811:Agbl3	UTSW	6	34799729	missense	probably damaging	1.00
R4059:Agbl3	UTSW	6	34846899	missense	probably damaging	1.00
R4499:Agbl3	UTSW	6	34857598	missense	probably benign	0.00
R4687:Agbl3	UTSW	6	34798326	missense	probably damaging	1.00
R4854:Agbl3	UTSW	6	34785284	missense	probably damaging	0.97
R5354:Agbl3	UTSW	6	34814752	missense	probably benign	0.03
R5386:Agbl3	UTSW	6	34799196	missense	probably damaging	1.00
R5897:Agbl3	UTSW	6	34803573	missense	probably benign	0.21
R6018:Agbl3	UTSW	6	34799255	missense	probably damaging	1.00
R6148:Agbl3	UTSW	6	34857753	missense	possibly damaging	0.87
R6305:Agbl3	UTSW	6	34782210	missense	unknown
R6525:Agbl3	UTSW	6	34803594	nonsense	probably null
R6546:Agbl3	UTSW	6	34799299	missense	probably damaging	1.00
R6743:Agbl3	UTSW	6	34846953	missense	probably benign	0.03
R6986:Agbl3	UTSW	6	34839452	missense	probably benign	0.42
R7023:Agbl3	UTSW	6	34814769	missense	probably benign	0.02
R7469:Agbl3	UTSW	6	34814414	missense	probably damaging	1.00
R7631:Agbl3	UTSW	6	34857671	missense	possibly damaging	0.95
R7658:Agbl3	UTSW	6	34832508	missense	probably benign	0.11
R7743:Agbl3	UTSW	6	34846830	missense	probably damaging	1.00
R7801:Agbl3	UTSW	6	34839365	missense	probably benign	0.00
R8033:Agbl3	UTSW	6	34839494	missense	possibly damaging	0.95
R8203:Agbl3	UTSW	6	34799479	missense	probably damaging	1.00
R8769:Agbl3	UTSW	6	34857614	missense	probably damaging	0.96
R9072:Agbl3	UTSW	6	34799452	missense	probably damaging	1.00
R9073:Agbl3	UTSW	6	34799452	missense	probably damaging	1.00
R9210:Agbl3	UTSW	6	34798242	missense	probably damaging	0.98
R9255:Agbl3	UTSW	6	34812905	missense	probably damaging	1.00
R9536:Agbl3	UTSW	6	34846926	missense	probably benign
R9560:Agbl3	UTSW	6	34846908	missense	possibly damaging	0.94
R9662:Agbl3	UTSW	6	34832533	nonsense	probably null
RF014:Agbl3	UTSW	6	34799358	missense	possibly damaging	0.53
Z1177:Agbl3	UTSW	6	34799408	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGGTGTATGTAGTAATCACCCTGTG -3'
(R):5'- AACACATGGCAAATGACAGTGC -3'

Sequencing Primer
(F):5'- TGTAGTAATCACCCTGTGACTATTAC -3'
(R):5'- GGCAAATGACAGTGCTTATTATTG -3'

Posted On

2019-10-07