Incidental Mutation 'R7411:Nphp4'
ID 575062
Institutional Source Beutler Lab
Gene Symbol Nphp4
Ensembl Gene ENSMUSG00000039577
Gene Name nephronophthisis 4 (juvenile) homolog (human)
Synonyms nmf192, 4930564O18Rik
MMRRC Submission 045492-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.133) question?
Stock # R7411 (G1)
Quality Score 203.009
Status Not validated
Chromosome 4
Chromosomal Location 152561163-152647640 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 152639174 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 935 (I935N)
Ref Sequence ENSEMBL: ENSMUSP00000049920 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056567] [ENSMUST00000081393]
AlphaFold P59240
Predicted Effect probably benign
Transcript: ENSMUST00000056567
AA Change: I935N

PolyPhen 2 Score 0.251 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000049920
Gene: ENSMUSG00000039577
AA Change: I935N

DomainStartEndE-ValueType
low complexity region 317 333 N/A INTRINSIC
low complexity region 367 380 N/A INTRINSIC
low complexity region 473 484 N/A INTRINSIC
low complexity region 507 530 N/A INTRINSIC
low complexity region 896 909 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000081393
AA Change: I935N

PolyPhen 2 Score 0.251 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000080128
Gene: ENSMUSG00000039577
AA Change: I935N

DomainStartEndE-ValueType
low complexity region 317 333 N/A INTRINSIC
low complexity region 367 380 N/A INTRINSIC
low complexity region 473 484 N/A INTRINSIC
low complexity region 507 530 N/A INTRINSIC
low complexity region 896 909 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in renal tubular development and function. This protein interacts with nephrocystin, and belongs to a multifunctional complex that is localized to actin- and microtubule-based structures. Mutations in this gene are associated with nephronophthisis type 4, a renal disease, and with Senior-Loken syndrome type 4, a combination of nephronophthisis and retinitis pigmentosa. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mutant mice have a mottled retina with photoreceptor degeneration and male infertility associated with oligozoospermia and asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik C T 19: 3,767,241 (GRCm39) T276I possibly damaging Het
Abca17 A G 17: 24,547,543 (GRCm39) I277T possibly damaging Het
Abcb11 C T 2: 69,134,280 (GRCm39) probably null Het
Abcc12 C A 8: 87,287,479 (GRCm39) R122L possibly damaging Het
Abcc8 A G 7: 45,815,341 (GRCm39) probably null Het
Adam28 C T 14: 68,864,396 (GRCm39) R469K probably damaging Het
Adamts18 T C 8: 114,504,362 (GRCm39) Y243C probably damaging Het
Agbl3 T C 6: 34,791,754 (GRCm39) S619P probably damaging Het
Alpk3 A T 7: 80,742,600 (GRCm39) T806S probably benign Het
Armh3 A C 19: 45,953,874 (GRCm39) V170G probably benign Het
Atoh1 T A 6: 64,706,914 (GRCm39) I203N probably damaging Het
Cables1 A G 18: 11,973,572 (GRCm39) E237G probably benign Het
Cacna1d A G 14: 30,074,947 (GRCm39) M1T probably null Het
Ccdc91 C T 6: 147,493,696 (GRCm39) Q363* probably null Het
Cdhr17 A T 5: 17,029,763 (GRCm39) T500S possibly damaging Het
Ceacam5 T A 7: 17,484,678 (GRCm39) D473E probably damaging Het
Cfap54 T A 10: 92,704,617 (GRCm39) D2821V unknown Het
Clca3a2 A G 3: 144,507,860 (GRCm39) S737P probably damaging Het
Clec4n T A 6: 123,209,145 (GRCm39) M70K probably benign Het
Dnai3 A G 3: 145,802,900 (GRCm39) V97A probably damaging Het
Dstyk G A 1: 132,345,404 (GRCm39) G21S probably benign Het
Efcab3 T G 11: 104,890,549 (GRCm39) N4210K probably benign Het
Enpp5 A G 17: 44,392,366 (GRCm39) D265G probably damaging Het
Gabrb1 T C 5: 72,279,538 (GRCm39) probably null Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 141,794,554 (GRCm39) probably benign Het
Guk1 A G 11: 59,076,811 (GRCm39) F91L Het
Ints1 C T 5: 139,750,015 (GRCm39) E961K possibly damaging Het
Irx2 T A 13: 72,777,182 (GRCm39) M1K probably null Het
Jrk C T 15: 74,579,048 (GRCm39) R79H possibly damaging Het
Kcnu1 G T 8: 26,382,116 (GRCm39) V489L probably damaging Het
Kctd7 C T 5: 130,181,265 (GRCm39) T209M probably benign Het
Kdm5a T A 6: 120,403,776 (GRCm39) V1127E probably damaging Het
Klk6 A G 7: 43,476,367 (GRCm39) H69R probably damaging Het
Lck T C 4: 129,445,763 (GRCm39) K340R probably benign Het
Lrrc75a A G 11: 62,496,734 (GRCm39) L276P probably damaging Het
Med25 A G 7: 44,527,667 (GRCm39) W730R probably damaging Het
Muc4 T C 16: 32,570,140 (GRCm39) V400A probably benign Het
Myl10 G C 5: 136,726,825 (GRCm39) V70L probably benign Het
Myt1 C A 2: 181,456,899 (GRCm39) H906Q probably damaging Het
Ncl A T 1: 86,278,564 (GRCm39) F673I probably damaging Het
Nfe2l1 G T 11: 96,713,009 (GRCm39) T216N probably benign Het
Nos2 G A 11: 78,835,681 (GRCm39) probably null Het
Ntn1 G A 11: 68,276,915 (GRCm39) A11V probably benign Het
Or2t26 A T 11: 49,039,821 (GRCm39) M246L probably benign Het
Or4c10b T C 2: 89,711,605 (GRCm39) V145A probably damaging Het
Pate11 T C 9: 36,386,980 (GRCm39) V16A possibly damaging Het
Pcdha12 A G 18: 37,154,661 (GRCm39) Y460C probably damaging Het
Pcdha4 G T 18: 37,086,111 (GRCm39) R98L probably benign Het
Pitpnc1 A G 11: 107,103,398 (GRCm39) S234P probably damaging Het
Pmfbp1 A T 8: 110,240,503 (GRCm39) Y195F probably damaging Het
Prl6a1 T C 13: 27,502,125 (GRCm39) I164T probably damaging Het
Ptpn18 G A 1: 34,511,273 (GRCm39) probably null Het
Rhbdl2 G A 4: 123,723,435 (GRCm39) A280T possibly damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,229,139 (GRCm39) probably benign Het
Sema3a T G 5: 13,566,230 (GRCm39) Y171* probably null Het
Set A G 2: 29,956,897 (GRCm39) E22G probably benign Het
Sirpb1b A T 3: 15,608,057 (GRCm39) D229E probably benign Het
Slc12a2 A T 18: 58,074,085 (GRCm39) I1096F probably benign Het
Slc30a5 T C 13: 100,954,688 (GRCm39) I159V probably benign Het
Slc35f3 CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 8: 127,115,777 (GRCm39) probably benign Het
Slc6a20b A G 9: 123,434,013 (GRCm39) I275T probably benign Het
Speer1e T A 5: 11,233,116 (GRCm39) probably null Het
Stradb A C 1: 59,027,677 (GRCm39) D69A possibly damaging Het
Supt16 A T 14: 52,415,508 (GRCm39) V409E probably damaging Het
Tcea2 A G 2: 181,328,457 (GRCm39) N195S probably damaging Het
Thumpd3 T C 6: 113,033,072 (GRCm39) V270A possibly damaging Het
Urgcp T A 11: 5,668,116 (GRCm39) H117L probably benign Het
Vps13c T A 9: 67,879,283 (GRCm39) M3408K probably damaging Het
Wdfy4 A C 14: 32,828,088 (GRCm39) M1078R Het
Ypel5 G A 17: 73,153,439 (GRCm39) probably null Het
Other mutations in Nphp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Nphp4 APN 4 152,621,766 (GRCm39) splice site probably benign
IGL00963:Nphp4 APN 4 152,622,318 (GRCm39) missense probably benign 0.01
IGL01571:Nphp4 APN 4 152,640,839 (GRCm39) missense probably benign 0.21
IGL01707:Nphp4 APN 4 152,623,440 (GRCm39) missense probably benign 0.00
IGL01837:Nphp4 APN 4 152,573,338 (GRCm39) missense probably damaging 0.96
IGL02341:Nphp4 APN 4 152,639,926 (GRCm39) splice site probably benign
IGL02558:Nphp4 APN 4 152,639,988 (GRCm39) missense probably damaging 1.00
IGL02563:Nphp4 APN 4 152,640,677 (GRCm39) missense probably benign 0.00
IGL02712:Nphp4 APN 4 152,640,732 (GRCm39) missense probably damaging 1.00
IGL03023:Nphp4 APN 4 152,608,692 (GRCm39) splice site probably null
R0280:Nphp4 UTSW 4 152,636,393 (GRCm39) splice site probably benign
R0317:Nphp4 UTSW 4 152,636,388 (GRCm39) critical splice donor site probably null
R0410:Nphp4 UTSW 4 152,641,503 (GRCm39) missense probably benign
R0433:Nphp4 UTSW 4 152,602,629 (GRCm39) missense probably benign 0.00
R0706:Nphp4 UTSW 4 152,640,074 (GRCm39) missense probably damaging 0.98
R0785:Nphp4 UTSW 4 152,646,566 (GRCm39) missense possibly damaging 0.58
R0890:Nphp4 UTSW 4 152,582,677 (GRCm39) missense possibly damaging 0.93
R0930:Nphp4 UTSW 4 152,622,512 (GRCm39) missense probably benign 0.01
R1202:Nphp4 UTSW 4 152,573,186 (GRCm39) splice site probably null
R1203:Nphp4 UTSW 4 152,573,289 (GRCm39) missense probably damaging 0.96
R1366:Nphp4 UTSW 4 152,587,383 (GRCm39) missense probably damaging 0.96
R1452:Nphp4 UTSW 4 152,631,475 (GRCm39) missense probably damaging 0.99
R1598:Nphp4 UTSW 4 152,646,547 (GRCm39) missense probably benign 0.00
R1699:Nphp4 UTSW 4 152,581,121 (GRCm39) missense probably damaging 0.99
R2007:Nphp4 UTSW 4 152,639,111 (GRCm39) missense probably damaging 0.97
R2082:Nphp4 UTSW 4 152,643,821 (GRCm39) missense probably benign 0.38
R2264:Nphp4 UTSW 4 152,587,465 (GRCm39) splice site probably benign
R2280:Nphp4 UTSW 4 152,641,500 (GRCm39) missense possibly damaging 0.95
R2281:Nphp4 UTSW 4 152,641,500 (GRCm39) missense possibly damaging 0.95
R2926:Nphp4 UTSW 4 152,602,596 (GRCm39) missense probably damaging 0.99
R3764:Nphp4 UTSW 4 152,622,474 (GRCm39) splice site probably benign
R4084:Nphp4 UTSW 4 152,573,248 (GRCm39) missense probably damaging 1.00
R4091:Nphp4 UTSW 4 152,631,475 (GRCm39) missense probably damaging 0.97
R4240:Nphp4 UTSW 4 152,640,141 (GRCm39) missense probably benign 0.07
R4701:Nphp4 UTSW 4 152,581,116 (GRCm39) missense probably damaging 1.00
R4778:Nphp4 UTSW 4 152,640,748 (GRCm39) missense probably benign 0.44
R4783:Nphp4 UTSW 4 152,639,003 (GRCm39) missense probably benign 0.00
R4784:Nphp4 UTSW 4 152,639,003 (GRCm39) missense probably benign 0.00
R4974:Nphp4 UTSW 4 152,622,250 (GRCm39) missense probably damaging 1.00
R5053:Nphp4 UTSW 4 152,628,919 (GRCm39) splice site probably null
R5117:Nphp4 UTSW 4 152,608,689 (GRCm39) splice site probably null
R5128:Nphp4 UTSW 4 152,587,448 (GRCm39) missense probably benign 0.01
R5665:Nphp4 UTSW 4 152,590,942 (GRCm39) missense probably benign 0.25
R5890:Nphp4 UTSW 4 152,631,536 (GRCm39) missense probably benign 0.44
R6171:Nphp4 UTSW 4 152,628,906 (GRCm39) missense probably damaging 0.99
R6601:Nphp4 UTSW 4 152,587,464 (GRCm39) splice site probably null
R6772:Nphp4 UTSW 4 152,628,863 (GRCm39) missense probably benign 0.07
R6806:Nphp4 UTSW 4 152,622,558 (GRCm39) missense probably benign 0.02
R7006:Nphp4 UTSW 4 152,573,259 (GRCm39) missense probably benign 0.12
R7124:Nphp4 UTSW 4 152,640,141 (GRCm39) missense probably benign 0.07
R7381:Nphp4 UTSW 4 152,583,460 (GRCm39) missense possibly damaging 0.94
R7638:Nphp4 UTSW 4 152,638,991 (GRCm39) missense probably benign 0.08
R7814:Nphp4 UTSW 4 152,628,860 (GRCm39) missense probably damaging 1.00
R7814:Nphp4 UTSW 4 152,608,729 (GRCm39) missense possibly damaging 0.93
R7841:Nphp4 UTSW 4 152,581,140 (GRCm39) missense probably benign 0.01
R8346:Nphp4 UTSW 4 152,645,778 (GRCm39) missense probably damaging 1.00
R8479:Nphp4 UTSW 4 152,608,747 (GRCm39) missense probably benign 0.01
R8847:Nphp4 UTSW 4 152,590,863 (GRCm39) missense probably damaging 1.00
R8995:Nphp4 UTSW 4 152,623,345 (GRCm39) missense probably damaging 1.00
R8997:Nphp4 UTSW 4 152,623,345 (GRCm39) missense probably damaging 1.00
R9075:Nphp4 UTSW 4 152,591,905 (GRCm39) missense probably damaging 1.00
R9089:Nphp4 UTSW 4 152,645,673 (GRCm39) missense possibly damaging 0.87
R9191:Nphp4 UTSW 4 152,640,687 (GRCm39) missense probably damaging 1.00
R9274:Nphp4 UTSW 4 152,640,056 (GRCm39) missense probably benign 0.05
R9311:Nphp4 UTSW 4 152,608,714 (GRCm39) missense probably damaging 0.99
R9383:Nphp4 UTSW 4 152,628,918 (GRCm39) critical splice donor site probably null
R9628:Nphp4 UTSW 4 152,568,966 (GRCm39) missense probably damaging 1.00
R9711:Nphp4 UTSW 4 152,623,434 (GRCm39) missense possibly damaging 0.77
R9712:Nphp4 UTSW 4 152,631,521 (GRCm39) missense probably benign 0.17
R9752:Nphp4 UTSW 4 152,621,737 (GRCm39) missense probably benign 0.00
R9790:Nphp4 UTSW 4 152,646,605 (GRCm39) missense probably null 0.64
R9791:Nphp4 UTSW 4 152,646,605 (GRCm39) missense probably null 0.64
T0970:Nphp4 UTSW 4 152,640,836 (GRCm39) missense probably damaging 1.00
X0058:Nphp4 UTSW 4 152,644,164 (GRCm39) missense possibly damaging 0.95
Z1177:Nphp4 UTSW 4 152,602,653 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTAGGAAAGCGTGTGGTAC -3'
(R):5'- GTAATGACACAGGCCTCTGAG -3'

Sequencing Primer
(F):5'- TGTGGTACAGGCCCAGAG -3'
(R):5'- CCTCTGAGTATGGACCTCTGAG -3'
Posted On 2019-10-07