Incidental Mutation 'R7411:Adam28'
ID575107
Institutional Source Beutler Lab
Gene Symbol Adam28
Ensembl Gene ENSMUSG00000014725
Gene Namea disintegrin and metallopeptidase domain 28
SynonymsD430033C21Rik, C130072N01Rik, MDC-L, Dtgn1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R7411 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location68606027-68655842 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 68626947 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Lysine at position 469 (R469K)
Ref Sequence ENSEMBL: ENSMUSP00000022642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022642] [ENSMUST00000111072] [ENSMUST00000224039]
Predicted Effect probably damaging
Transcript: ENSMUST00000022642
AA Change: R469K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022642
Gene: ENSMUSG00000014725
AA Change: R469K

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Pep_M12B_propep 31 158 5.5e-34 PFAM
Pfam:Reprolysin_4 205 387 1.5e-14 PFAM
Pfam:Reprolysin_5 205 388 9.7e-19 PFAM
Pfam:Reprolysin 206 402 5.6e-70 PFAM
Pfam:Reprolysin_2 226 392 1e-16 PFAM
Pfam:Reprolysin_3 230 353 1.2e-21 PFAM
DISIN 419 494 2.1e-36 SMART
ACR 495 623 1.84e-52 SMART
EGF 631 660 3.01e0 SMART
transmembrane domain 667 689 N/A INTRINSIC
low complexity region 738 753 N/A INTRINSIC
low complexity region 757 765 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111072
AA Change: R469K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106701
Gene: ENSMUSG00000014725
AA Change: R469K

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Pep_M12B_propep 31 158 5.3e-34 PFAM
Pfam:Reprolysin_4 205 387 1.5e-14 PFAM
Pfam:Reprolysin_5 205 388 9.3e-19 PFAM
Pfam:Reprolysin 206 402 5.3e-70 PFAM
Pfam:Reprolysin_2 226 392 9.9e-17 PFAM
Pfam:Reprolysin_3 230 353 1.1e-21 PFAM
DISIN 419 494 2.1e-36 SMART
ACR 495 623 1.84e-52 SMART
EGF 631 660 3.01e0 SMART
transmembrane domain 667 689 N/A INTRINSIC
low complexity region 738 753 N/A INTRINSIC
low complexity region 757 765 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000224039
AA Change: R469K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are typically membrane-anchored, although a form of this protein may be secreted. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate a mature protein product. This protein may bind to integrins and regulate lymphocyte migration by enhancing cell adhesion. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik C T 19: 3,717,241 T276I possibly damaging Het
9130011E15Rik A C 19: 45,965,435 V170G probably benign Het
Abca17 A G 17: 24,328,569 I277T possibly damaging Het
Abcb11 C T 2: 69,303,936 probably null Het
Abcc12 C A 8: 86,560,850 R122L possibly damaging Het
Abcc8 A G 7: 46,165,917 probably null Het
Adamts18 T C 8: 113,777,730 Y243C probably damaging Het
Agbl3 T C 6: 34,814,819 S619P probably damaging Het
Alpk3 A T 7: 81,092,852 T806S probably benign Het
Atoh1 T A 6: 64,729,930 I203N probably damaging Het
Cables1 A G 18: 11,840,515 E237G probably benign Het
Cacna1d A G 14: 30,352,990 M1T probably null Het
Ccdc91 C T 6: 147,592,198 Q363* probably null Het
Ceacam5 T A 7: 17,750,753 D473E probably damaging Het
Cfap54 T A 10: 92,868,755 D2821V unknown Het
Clca3a2 A G 3: 144,802,099 S737P probably damaging Het
Clec4n T A 6: 123,232,186 M70K probably benign Het
Dstyk G A 1: 132,417,666 G21S probably benign Het
Enpp5 A G 17: 44,081,475 D265G probably damaging Het
Gabrb1 T C 5: 72,122,195 probably null Het
Gm11639 T G 11: 104,999,723 N4210K probably benign Het
Gm28710 A T 5: 16,824,765 T500S possibly damaging Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Gm5861 T A 5: 11,183,149 probably null Het
Gm9513 T C 9: 36,475,684 V16A possibly damaging Het
Guk1 A G 11: 59,185,985 F91L Het
Ints1 C T 5: 139,764,260 E961K possibly damaging Het
Irx2 T A 13: 72,629,063 M1K probably null Het
Jrk C T 15: 74,707,199 R79H possibly damaging Het
Kcnu1 G T 8: 25,892,088 V489L probably damaging Het
Kctd7 C T 5: 130,152,424 T209M probably benign Het
Kdm5a T A 6: 120,426,815 V1127E probably damaging Het
Klk6 A G 7: 43,826,943 H69R probably damaging Het
Lck T C 4: 129,551,970 K340R probably benign Het
Lrrc75a A G 11: 62,605,908 L276P probably damaging Het
Med25 A G 7: 44,878,243 W730R probably damaging Het
Muc4 T C 16: 32,751,322 V400A probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Myt1 C A 2: 181,815,106 H906Q probably damaging Het
Ncl A T 1: 86,350,842 F673I probably damaging Het
Nfe2l1 G T 11: 96,822,183 T216N probably benign Het
Nos2 G A 11: 78,944,855 probably null Het
Nphp4 T A 4: 152,554,717 I935N probably benign Het
Ntn1 G A 11: 68,386,089 A11V probably benign Het
Olfr1257 T C 2: 89,881,261 V145A probably damaging Het
Olfr1395 A T 11: 49,148,994 M246L probably benign Het
Pcdha12 A G 18: 37,021,608 Y460C probably damaging Het
Pcdha4 G T 18: 36,953,058 R98L probably benign Het
Pitpnc1 A G 11: 107,212,572 S234P probably damaging Het
Pmfbp1 A T 8: 109,513,871 Y195F probably damaging Het
Prl6a1 T C 13: 27,318,142 I164T probably damaging Het
Ptpn18 G A 1: 34,472,192 probably null Het
Rhbdl2 G A 4: 123,829,642 A280T possibly damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,579,932 probably benign Het
Sema3a T G 5: 13,516,263 Y171* probably null Het
Set A G 2: 30,066,885 E22G probably benign Het
Sirpb1b A T 3: 15,542,997 D229E probably benign Het
Slc12a2 A T 18: 57,941,013 I1096F probably benign Het
Slc30a5 T C 13: 100,818,180 I159V probably benign Het
Slc35f3 CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 8: 126,389,038 unknown Het
Slc6a20b A G 9: 123,604,948 I275T probably benign Het
Stradb A C 1: 58,988,518 D69A possibly damaging Het
Supt16 A T 14: 52,178,051 V409E probably damaging Het
Tcea2 A G 2: 181,686,664 N195S probably damaging Het
Thumpd3 T C 6: 113,056,111 V270A possibly damaging Het
Urgcp T A 11: 5,718,116 H117L probably benign Het
Vps13c T A 9: 67,972,001 M3408K probably damaging Het
Wdfy4 A C 14: 33,106,131 M1078R Het
Wdr63 A G 3: 146,097,145 V97A probably damaging Het
Ypel5 G A 17: 72,846,444 probably null Het
Other mutations in Adam28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Adam28 APN 14 68622120 missense possibly damaging 0.47
IGL00654:Adam28 APN 14 68649428 missense probably benign 0.00
IGL01021:Adam28 APN 14 68642114 missense probably benign
IGL01099:Adam28 APN 14 68637329 critical splice donor site probably null
IGL01349:Adam28 APN 14 68611006 missense probably benign 0.01
IGL01744:Adam28 APN 14 68607507 missense probably benign 0.07
IGL01805:Adam28 APN 14 68642091 missense probably benign 0.09
IGL02007:Adam28 APN 14 68633219 missense possibly damaging 0.69
IGL02828:Adam28 APN 14 68646870 missense possibly damaging 0.46
IGL03180:Adam28 APN 14 68637434 missense probably damaging 1.00
IGL03355:Adam28 APN 14 68634803 splice site probably benign
IGL02980:Adam28 UTSW 14 68619806 missense probably benign 0.01
PIT4453001:Adam28 UTSW 14 68634876 missense probably benign 0.00
R0184:Adam28 UTSW 14 68637373 missense probably benign 0.33
R0321:Adam28 UTSW 14 68617751 missense probably damaging 0.97
R0329:Adam28 UTSW 14 68617739 missense probably damaging 0.96
R0494:Adam28 UTSW 14 68630792 splice site probably benign
R0605:Adam28 UTSW 14 68606600 unclassified probably benign
R0732:Adam28 UTSW 14 68637347 missense probably benign 0.00
R0959:Adam28 UTSW 14 68607938 missense possibly damaging 0.93
R1319:Adam28 UTSW 14 68609129 missense probably benign 0.28
R1745:Adam28 UTSW 14 68633171 missense probably benign 0.04
R1836:Adam28 UTSW 14 68649421 missense possibly damaging 0.85
R1838:Adam28 UTSW 14 68639210 missense possibly damaging 0.53
R1839:Adam28 UTSW 14 68639210 missense possibly damaging 0.53
R1850:Adam28 UTSW 14 68639195 missense probably benign 0.01
R1912:Adam28 UTSW 14 68644331 missense probably benign 0.24
R2830:Adam28 UTSW 14 68626914 missense possibly damaging 0.65
R2889:Adam28 UTSW 14 68634845 missense possibly damaging 0.85
R3977:Adam28 UTSW 14 68610994 missense probably benign 0.20
R3978:Adam28 UTSW 14 68610994 missense probably benign 0.20
R3979:Adam28 UTSW 14 68610994 missense probably benign 0.20
R4282:Adam28 UTSW 14 68647706 missense possibly damaging 0.92
R4416:Adam28 UTSW 14 68622082 critical splice donor site probably null
R4690:Adam28 UTSW 14 68642048 missense probably benign 0.01
R4724:Adam28 UTSW 14 68626877 missense probably damaging 0.99
R4768:Adam28 UTSW 14 68634815 missense possibly damaging 0.46
R4883:Adam28 UTSW 14 68638103 missense probably damaging 0.99
R5054:Adam28 UTSW 14 68617715 missense probably damaging 1.00
R5710:Adam28 UTSW 14 68609908 missense probably damaging 0.96
R5835:Adam28 UTSW 14 68655681 missense possibly damaging 0.96
R6002:Adam28 UTSW 14 68642062 missense probably benign
R6054:Adam28 UTSW 14 68642152 missense probably benign 0.01
R6349:Adam28 UTSW 14 68633172 missense probably benign 0.29
R6449:Adam28 UTSW 14 68630667 missense probably benign 0.31
R6455:Adam28 UTSW 14 68633208 missense probably damaging 1.00
R6831:Adam28 UTSW 14 68618127 missense probably benign 0.04
R6833:Adam28 UTSW 14 68618127 missense probably benign 0.04
R7212:Adam28 UTSW 14 68637397 missense probably damaging 0.99
R7422:Adam28 UTSW 14 68626877 missense probably damaging 1.00
R7516:Adam28 UTSW 14 68630676 missense probably damaging 1.00
R7649:Adam28 UTSW 14 68634833 missense probably benign 0.12
R7765:Adam28 UTSW 14 68609106 critical splice donor site probably null
Z1177:Adam28 UTSW 14 68626784 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTACCTGGACCCCACATGTC -3'
(R):5'- ATCTGAGATATTGCCCATGTGTCTC -3'

Sequencing Primer
(F):5'- ACATGTCCATGCACTGCTG -3'
(R):5'- TGAAGACTCAGACTATTGGCC -3'
Posted On2019-10-07