Incidental Mutation 'R7411:Slc30a5'
ID 575103
Institutional Source Beutler Lab
Gene Symbol Slc30a5
Ensembl Gene ENSMUSG00000021629
Gene Name solute carrier family 30 (zinc transporter), member 5
Synonyms Zntl1, Znt5, 1810010K08Rik, ZTL1, ZnT-5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.756) question?
Stock # R7411 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 100802648-100833427 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 100818180 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 159 (I159V)
Ref Sequence ENSEMBL: ENSMUSP00000065764 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067246] [ENSMUST00000225922]
AlphaFold Q8R4H9
Predicted Effect probably benign
Transcript: ENSMUST00000067246
AA Change: I159V

PolyPhen 2 Score 0.147 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000065764
Gene: ENSMUSG00000021629
AA Change: I159V

DomainStartEndE-ValueType
low complexity region 6 23 N/A INTRINSIC
transmembrane domain 56 75 N/A INTRINSIC
transmembrane domain 96 113 N/A INTRINSIC
transmembrane domain 128 145 N/A INTRINSIC
transmembrane domain 150 164 N/A INTRINSIC
transmembrane domain 192 214 N/A INTRINSIC
transmembrane domain 235 254 N/A INTRINSIC
transmembrane domain 264 286 N/A INTRINSIC
transmembrane domain 299 321 N/A INTRINSIC
transmembrane domain 341 360 N/A INTRINSIC
Pfam:Cation_efflux 417 645 1.9e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000225086
Predicted Effect probably benign
Transcript: ENSMUST00000225922
AA Change: I159V

PolyPhen 2 Score 0.118 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLC30A/ZnT family of zinc transporter proteins. ZnT proteins mediate both cellular zinc efflux and zinc sequestration into membrane-bound organelles. The encoded protein plays a role in the early secretory pathway as a heterodimer with zinc transporter 6, and may also regulate zinc sequestration into secretory granules of pancreatic beta cells. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 19. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice are growth retarded and exhibit skeletal defects including reduced bone density. The majority of mutant male mice die suddenly when they reach reproductive age due to bradyarrhythmia, whereas female mice live a normal term. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik C T 19: 3,717,241 T276I possibly damaging Het
9130011E15Rik A C 19: 45,965,435 V170G probably benign Het
Abca17 A G 17: 24,328,569 I277T possibly damaging Het
Abcb11 C T 2: 69,303,936 probably null Het
Abcc12 C A 8: 86,560,850 R122L possibly damaging Het
Abcc8 A G 7: 46,165,917 probably null Het
Adam28 C T 14: 68,626,947 R469K probably damaging Het
Adamts18 T C 8: 113,777,730 Y243C probably damaging Het
Agbl3 T C 6: 34,814,819 S619P probably damaging Het
Alpk3 A T 7: 81,092,852 T806S probably benign Het
Atoh1 T A 6: 64,729,930 I203N probably damaging Het
Cables1 A G 18: 11,840,515 E237G probably benign Het
Cacna1d A G 14: 30,352,990 M1T probably null Het
Ccdc91 C T 6: 147,592,198 Q363* probably null Het
Ceacam5 T A 7: 17,750,753 D473E probably damaging Het
Cfap54 T A 10: 92,868,755 D2821V unknown Het
Clca3a2 A G 3: 144,802,099 S737P probably damaging Het
Clec4n T A 6: 123,232,186 M70K probably benign Het
Dstyk G A 1: 132,417,666 G21S probably benign Het
Enpp5 A G 17: 44,081,475 D265G probably damaging Het
Gabrb1 T C 5: 72,122,195 probably null Het
Gm11639 T G 11: 104,999,723 N4210K probably benign Het
Gm28710 A T 5: 16,824,765 T500S possibly damaging Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Gm5861 T A 5: 11,183,149 probably null Het
Gm9513 T C 9: 36,475,684 V16A possibly damaging Het
Guk1 A G 11: 59,185,985 F91L Het
Ints1 C T 5: 139,764,260 E961K possibly damaging Het
Irx2 T A 13: 72,629,063 M1K probably null Het
Jrk C T 15: 74,707,199 R79H possibly damaging Het
Kcnu1 G T 8: 25,892,088 V489L probably damaging Het
Kctd7 C T 5: 130,152,424 T209M probably benign Het
Kdm5a T A 6: 120,426,815 V1127E probably damaging Het
Klk6 A G 7: 43,826,943 H69R probably damaging Het
Lck T C 4: 129,551,970 K340R probably benign Het
Lrrc75a A G 11: 62,605,908 L276P probably damaging Het
Med25 A G 7: 44,878,243 W730R probably damaging Het
Muc4 T C 16: 32,751,322 V400A probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Myt1 C A 2: 181,815,106 H906Q probably damaging Het
Ncl A T 1: 86,350,842 F673I probably damaging Het
Nfe2l1 G T 11: 96,822,183 T216N probably benign Het
Nos2 G A 11: 78,944,855 probably null Het
Nphp4 T A 4: 152,554,717 I935N probably benign Het
Ntn1 G A 11: 68,386,089 A11V probably benign Het
Olfr1257 T C 2: 89,881,261 V145A probably damaging Het
Olfr1395 A T 11: 49,148,994 M246L probably benign Het
Pcdha12 A G 18: 37,021,608 Y460C probably damaging Het
Pcdha4 G T 18: 36,953,058 R98L probably benign Het
Pitpnc1 A G 11: 107,212,572 S234P probably damaging Het
Pmfbp1 A T 8: 109,513,871 Y195F probably damaging Het
Prl6a1 T C 13: 27,318,142 I164T probably damaging Het
Ptpn18 G A 1: 34,472,192 probably null Het
Rhbdl2 G A 4: 123,829,642 A280T possibly damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,579,932 probably benign Het
Sema3a T G 5: 13,516,263 Y171* probably null Het
Set A G 2: 30,066,885 E22G probably benign Het
Sirpb1b A T 3: 15,542,997 D229E probably benign Het
Slc12a2 A T 18: 57,941,013 I1096F probably benign Het
Slc35f3 CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 8: 126,389,038 probably benign Het
Slc6a20b A G 9: 123,604,948 I275T probably benign Het
Stradb A C 1: 58,988,518 D69A possibly damaging Het
Supt16 A T 14: 52,178,051 V409E probably damaging Het
Tcea2 A G 2: 181,686,664 N195S probably damaging Het
Thumpd3 T C 6: 113,056,111 V270A possibly damaging Het
Urgcp T A 11: 5,718,116 H117L probably benign Het
Vps13c T A 9: 67,972,001 M3408K probably damaging Het
Wdfy4 A C 14: 33,106,131 M1078R Het
Wdr63 A G 3: 146,097,145 V97A probably damaging Het
Ypel5 G A 17: 72,846,444 probably null Het
Other mutations in Slc30a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Slc30a5 APN 13 100806666 missense probably damaging 1.00
IGL01647:Slc30a5 APN 13 100821145 missense possibly damaging 0.66
IGL02338:Slc30a5 APN 13 100803433 missense probably damaging 0.99
IGL02408:Slc30a5 APN 13 100813724 missense probably damaging 1.00
IGL02582:Slc30a5 APN 13 100812647 critical splice donor site probably null
IGL02987:Slc30a5 APN 13 100803915 missense probably damaging 1.00
IGL03025:Slc30a5 APN 13 100813887 missense probably damaging 0.99
IGL03064:Slc30a5 APN 13 100811310 missense probably damaging 1.00
IGL03089:Slc30a5 APN 13 100813830 missense probably benign 0.01
IGL03268:Slc30a5 APN 13 100806703 missense probably damaging 1.00
R0083:Slc30a5 UTSW 13 100803400 missense probably damaging 1.00
R0108:Slc30a5 UTSW 13 100803400 missense probably damaging 1.00
R0108:Slc30a5 UTSW 13 100803400 missense probably damaging 1.00
R0153:Slc30a5 UTSW 13 100826494 missense possibly damaging 0.46
R0542:Slc30a5 UTSW 13 100809285 splice site probably null
R0601:Slc30a5 UTSW 13 100814770 intron probably benign
R1125:Slc30a5 UTSW 13 100803413 missense probably damaging 1.00
R1434:Slc30a5 UTSW 13 100803442 missense probably damaging 0.98
R1673:Slc30a5 UTSW 13 100813383 missense probably benign 0.13
R1762:Slc30a5 UTSW 13 100813462 missense probably damaging 1.00
R1974:Slc30a5 UTSW 13 100813953 missense probably benign 0.06
R2082:Slc30a5 UTSW 13 100806533 critical splice donor site probably null
R2151:Slc30a5 UTSW 13 100803949 missense probably damaging 1.00
R2152:Slc30a5 UTSW 13 100803949 missense probably damaging 1.00
R2153:Slc30a5 UTSW 13 100803949 missense probably damaging 1.00
R3899:Slc30a5 UTSW 13 100818147 missense probably benign 0.18
R4009:Slc30a5 UTSW 13 100809233 missense probably damaging 1.00
R4010:Slc30a5 UTSW 13 100809233 missense probably damaging 1.00
R4270:Slc30a5 UTSW 13 100829013 missense probably benign 0.04
R4815:Slc30a5 UTSW 13 100813710 missense probably damaging 1.00
R5048:Slc30a5 UTSW 13 100806741 missense probably damaging 1.00
R5450:Slc30a5 UTSW 13 100821172 missense possibly damaging 0.81
R5638:Slc30a5 UTSW 13 100813872 nonsense probably null
R5892:Slc30a5 UTSW 13 100813302 missense probably damaging 1.00
R5911:Slc30a5 UTSW 13 100809092 missense probably damaging 1.00
R6453:Slc30a5 UTSW 13 100814689 missense probably benign 0.00
R6769:Slc30a5 UTSW 13 100813860 missense probably benign 0.19
R6795:Slc30a5 UTSW 13 100817069 missense probably damaging 1.00
R7020:Slc30a5 UTSW 13 100824913 splice site probably null
R7224:Slc30a5 UTSW 13 100809254 missense probably damaging 0.99
R7305:Slc30a5 UTSW 13 100811424 missense probably damaging 0.98
R7318:Slc30a5 UTSW 13 100813969 missense probably benign 0.13
R7563:Slc30a5 UTSW 13 100803972 missense probably benign 0.30
R8039:Slc30a5 UTSW 13 100813681 critical splice donor site probably null
R8061:Slc30a5 UTSW 13 100828911 missense probably damaging 0.99
R8973:Slc30a5 UTSW 13 100806694 missense probably damaging 0.99
R9150:Slc30a5 UTSW 13 100803407 nonsense probably null
R9352:Slc30a5 UTSW 13 100803872 missense probably benign 0.10
R9359:Slc30a5 UTSW 13 100813462 missense probably damaging 1.00
R9405:Slc30a5 UTSW 13 100813908 missense probably benign 0.00
R9407:Slc30a5 UTSW 13 100814706 nonsense probably null
R9628:Slc30a5 UTSW 13 100824914 critical splice donor site probably null
X0019:Slc30a5 UTSW 13 100813842 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGAATCTATGGAAGTGACACTTGTG -3'
(R):5'- TGAAGAATTTATCTCTGTGGCTTCC -3'

Sequencing Primer
(F):5'- AAGTGACACTTGTGTCTGTTGAG -3'
(R):5'- CACTCTGGATTGTCAATGCAAGGC -3'
Posted On 2019-10-07