Incidental Mutation 'R7424:Ddx5'
ID575941
Institutional Source Beutler Lab
Gene Symbol Ddx5
Ensembl Gene ENSMUSG00000020719
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 5
SynonymsHlr1, p68, 2600009A06Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7424 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location106780355-106789185 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 106782180 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 506 (N506K)
Ref Sequence ENSEMBL: ENSMUSP00000021062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021060] [ENSMUST00000021062] [ENSMUST00000123339] [ENSMUST00000126201] [ENSMUST00000127061] [ENSMUST00000127481] [ENSMUST00000129585] [ENSMUST00000133426] [ENSMUST00000134029] [ENSMUST00000155107]
Predicted Effect probably benign
Transcript: ENSMUST00000021060
SMART Domains Protein: ENSMUSP00000021060
Gene: ENSMUSG00000020718

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
SCOP:d1g5ha2 41 330 4e-36 SMART
Pfam:HGTP_anticodon 354 452 3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000021062
AA Change: N506K

PolyPhen 2 Score 0.120 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000021062
Gene: ENSMUSG00000020719
AA Change: N506K

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
Blast:DEXDc 24 86 9e-31 BLAST
DEXDc 113 316 7.67e-64 SMART
HELICc 355 436 3.57e-32 SMART
low complexity region 477 496 N/A INTRINSIC
Pfam:P68HR 498 532 8e-20 PFAM
Pfam:P68HR 551 583 5.2e-20 PFAM
low complexity region 592 603 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123339
SMART Domains Protein: ENSMUSP00000121733
Gene: ENSMUSG00000020719

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
Blast:DEXDc 24 86 7e-37 BLAST
Pfam:DEAD 118 161 1.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126201
SMART Domains Protein: ENSMUSP00000116583
Gene: ENSMUSG00000020718

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
PDB:1G5I|D 17 134 2e-70 PDB
SCOP:d1g5ha2 41 130 8e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127061
SMART Domains Protein: ENSMUSP00000117441
Gene: ENSMUSG00000020718

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
PDB:1G5I|D 17 170 1e-100 PDB
SCOP:d1g5ha2 41 163 1e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127481
SMART Domains Protein: ENSMUSP00000138184
Gene: ENSMUSG00000020719

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
Blast:DEXDc 24 70 2e-26 BLAST
PDB:4A4D|A 52 70 3e-7 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000129585
SMART Domains Protein: ENSMUSP00000116859
Gene: ENSMUSG00000020719

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
Blast:DEXDc 24 86 8e-37 BLAST
Pfam:DEAD 118 183 7.2e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133426
SMART Domains Protein: ENSMUSP00000138237
Gene: ENSMUSG00000020719

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
Blast:DEXDc 24 86 2e-31 BLAST
DEXDc 113 316 7.67e-64 SMART
Pfam:Helicase_C 359 406 1.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134029
SMART Domains Protein: ENSMUSP00000122755
Gene: ENSMUSG00000020718

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
PDB:1G5I|D 17 122 3e-69 PDB
SCOP:d1g5ha2 41 120 3e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155107
SMART Domains Protein: ENSMUSP00000118975
Gene: ENSMUSG00000020718

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
PDB:1G5I|D 17 122 3e-69 PDB
SCOP:d1g5ha2 41 120 3e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which is a RNA-dependent ATPase, and also a proliferation-associated nuclear antigen, specifically reacting with the simian virus 40 tumor antigen. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a reporter/null allele die around E11.5 displaying blood vessel malformations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik C T 8: 120,145,545 R71C probably damaging Het
Aanat A T 11: 116,595,629 probably benign Het
Ahrr G T 13: 74,257,545 S91* probably null Het
Ampd1 A T 3: 103,088,442 N223Y probably benign Het
Ankar T G 1: 72,680,058 N544T probably damaging Het
Ankk1 A G 9: 49,418,750 S302P possibly damaging Het
Bcr T C 10: 75,157,100 V809A probably benign Het
Bpifb2 A G 2: 153,890,540 N353S possibly damaging Het
Dnaja1 A T 4: 40,730,244 I239F probably benign Het
Ethe1 C T 7: 24,606,251 T141I probably damaging Het
Fam160b2 T C 14: 70,594,007 H29R probably damaging Het
Gdap2 A T 3: 100,202,066 I36F unknown Het
Gm13030 A T 4: 138,871,266 D115E unknown Het
Gm13103 C T 4: 143,853,209 P455S probably benign Het
Gm17019 A T 5: 15,029,372 L227Q probably damaging Het
Gm9195 T A 14: 72,435,777 E2517D possibly damaging Het
Gramd2 T A 9: 59,708,071 V39D possibly damaging Het
Hmcn1 C T 1: 150,630,266 W3836* probably null Het
Hspa14 C T 2: 3,489,041 D494N possibly damaging Het
Ifit2 A G 19: 34,573,198 N46S probably benign Het
Ifna6 A T 4: 88,827,807 E131V possibly damaging Het
Ift140 T C 17: 25,037,036 V504A possibly damaging Het
Irgc1 T C 7: 24,432,228 N388S probably damaging Het
Itgal T A 7: 127,317,365 V743E probably benign Het
Itih5 T C 2: 10,245,637 S716P probably damaging Het
Kcnab1 A T 3: 65,266,503 K78N possibly damaging Het
Kif1a A T 1: 93,054,317 V787E possibly damaging Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Krt39 A T 11: 99,518,091 V293E probably damaging Het
Lrrn4 A G 2: 132,869,743 F720S possibly damaging Het
Map2 G A 1: 66,414,824 A958T possibly damaging Het
Map3k9 A G 12: 81,724,097 S906P probably benign Het
Mdc1 T C 17: 35,853,309 S1250P probably benign Het
Meltf G A 16: 31,884,946 V164I probably damaging Het
Mtus1 C A 8: 41,022,406 V184F probably damaging Het
Myh1 A T 11: 67,213,663 D1015V probably damaging Het
Nkd1 G T 8: 88,585,175 V130L probably benign Het
Nsfl1c A G 2: 151,500,753 D81G probably benign Het
Nucb1 T C 7: 45,498,778 K204E possibly damaging Het
Nwd1 T G 8: 72,675,173 M774R possibly damaging Het
Olfr165 A T 16: 19,407,194 V274E probably damaging Het
Olfr262 A T 19: 12,240,954 S236T possibly damaging Het
Olfr654 G C 7: 104,588,700 E299Q probably damaging Het
Pcdh15 A T 10: 74,506,485 T1135S probably benign Het
Pfas A G 11: 69,000,092 I331T probably damaging Het
Plxna2 T A 1: 194,806,339 I1641N probably damaging Het
Ptar1 A T 19: 23,718,101 R311W probably damaging Het
Ranbp2 T G 10: 58,479,194 M1912R probably damaging Het
Rbm12 A G 2: 156,097,303 F350L possibly damaging Het
Sdhaf1 T C 7: 30,322,043 D96G probably benign Het
Serpinb6b T A 13: 32,968,667 M53K probably damaging Het
Sh2d6 A T 6: 72,517,164 L147Q probably benign Het
Slc19a2 T A 1: 164,260,876 C298S probably benign Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
St8sia2 T A 7: 73,960,902 Q211L possibly damaging Het
Sult2a2 T C 7: 13,734,897 I96T possibly damaging Het
Tab2 G T 10: 7,907,483 H678Q probably damaging Het
Tnfaip6 A G 2: 52,038,216 E14G probably benign Het
Trip11 A T 12: 101,885,198 L869H probably damaging Het
Tslp T C 18: 32,819,080 Y133H not run Het
Ttn T C 2: 76,740,990 I26520V probably damaging Het
Ttn A G 2: 76,932,143 V3374A unknown Het
Tubgcp2 T A 7: 140,007,924 I263F possibly damaging Het
Uaca A G 9: 60,870,110 E593G probably damaging Het
Unc13b C T 4: 43,172,235 T1021I unknown Het
Ush1c T A 7: 46,225,555 I131F probably benign Het
Usp24 C A 4: 106,379,107 D997E probably benign Het
Usp54 T C 14: 20,577,040 T517A probably benign Het
Vmn1r151 A T 7: 22,499,080 M200K possibly damaging Het
Vmn2r43 T C 7: 8,255,329 D295G probably damaging Het
Vmn2r70 G A 7: 85,563,868 P444S probably damaging Het
Vmn2r85 G T 10: 130,418,980 P612T probably damaging Het
Vps13d A T 4: 145,148,747 V1736D Het
Zbtb11 A T 16: 55,990,487 H336L probably benign Het
Other mutations in Ddx5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02110:Ddx5 APN 11 106785009 missense probably damaging 0.99
IGL02975:Ddx5 APN 11 106781885 missense probably benign 0.00
IGL03037:Ddx5 APN 11 106782104 missense possibly damaging 0.82
IGL03046:Ddx5 UTSW 11 106785045 missense probably damaging 1.00
R0544:Ddx5 UTSW 11 106782462 unclassified probably benign
R1186:Ddx5 UTSW 11 106783979 unclassified probably null
R1464:Ddx5 UTSW 11 106784885 missense probably benign 0.00
R1464:Ddx5 UTSW 11 106784885 missense probably benign 0.00
R1839:Ddx5 UTSW 11 106784897 missense probably benign 0.02
R3781:Ddx5 UTSW 11 106784520 missense probably benign 0.00
R3782:Ddx5 UTSW 11 106784520 missense probably benign 0.00
R4968:Ddx5 UTSW 11 106784127 missense probably damaging 1.00
R4973:Ddx5 UTSW 11 106785007 missense possibly damaging 0.94
R4995:Ddx5 UTSW 11 106785236 missense probably damaging 1.00
R5839:Ddx5 UTSW 11 106782206 missense probably damaging 0.97
R6263:Ddx5 UTSW 11 106788313 missense possibly damaging 0.83
R6314:Ddx5 UTSW 11 106788521 unclassified probably benign
R6341:Ddx5 UTSW 11 106785542 splice site probably null
R6707:Ddx5 UTSW 11 106782232 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCGTTCTGGTAAGTCCCTGTTG -3'
(R):5'- CCTCTTGTCTACAAAGTGGGATC -3'

Sequencing Primer
(F):5'- CAAAGCTCCCATTGGTGT -3'
(R):5'- TCTTGTCTACAAAGTGGGATCGGAAG -3'
Posted On2019-10-07