Incidental Mutation 'R7445:Prkra'
ID 577206
Institutional Source Beutler Lab
Gene Symbol Prkra
Ensembl Gene ENSMUSG00000002731
Gene Name protein kinase, interferon inducible double stranded RNA dependent activator
Synonyms lear, PRK, Pact, RAX
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.463) question?
Stock # R7445 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 76629898-76648015 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 76633598 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 240 (D240G)
Ref Sequence ENSEMBL: ENSMUSP00000002808 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002808]
AlphaFold Q9WTX2
Predicted Effect probably benign
Transcript: ENSMUST00000002808
AA Change: D240G

PolyPhen 2 Score 0.248 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000002808
Gene: ENSMUSG00000002731
AA Change: D240G

DomainStartEndE-ValueType
DSRM 35 100 4.63e-24 SMART
DSRM 127 193 2.23e-17 SMART
DSRM 241 307 1.16e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein kinase activated by double-stranded RNA which mediates the effects of interferon in response to viral infection. Mutations in this gene have been associated with dystonia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for a deletion of the entire gene show embryonic lethality prior to implantation. Mice homozygous for a deletion in the last exon are viable but exhibit small size, turbinate hypoplasia, short snout, severe microtia, outer and middle ear defects, and impaired hearing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T A 5: 63,898,619 S233T probably damaging Het
1700034E13Rik T A 18: 52,660,481 C29S probably damaging Het
1700061G19Rik G A 17: 56,882,973 R333Q possibly damaging Het
9130409I23Rik A G 1: 181,055,012 N113S possibly damaging Het
Ank3 A G 10: 69,992,124 T2208A Het
Ap4s1 T C 12: 51,738,641 L132P probably damaging Het
Ascl4 C T 10: 85,928,500 R4C probably benign Het
Brd7 A T 8: 88,361,708 Y18N probably damaging Het
Cacna2d3 A G 14: 29,058,618 S648P possibly damaging Het
Camta1 C T 4: 151,144,291 E695K possibly damaging Het
Ccdc28b A G 4: 129,622,607 F53L probably benign Het
Chaf1a A G 17: 56,062,170 D467G possibly damaging Het
Cnnm1 G A 19: 43,440,821 R126H possibly damaging Het
Cog5 T G 12: 31,919,672 S730R possibly damaging Het
Col11a1 A T 3: 114,193,929 E1374D unknown Het
Csmd1 A G 8: 16,158,254 I1229T possibly damaging Het
Dnajc30 T C 5: 135,064,378 L43P probably damaging Het
Eif3f C T 7: 108,934,658 T76M unknown Het
Ermap G A 4: 119,188,710 T42I unknown Het
Gpd1l C T 9: 114,920,674 G25S probably damaging Het
Heatr1 G T 13: 12,431,038 W1632L possibly damaging Het
Ice1 T C 13: 70,596,167 D29G Het
Ipo8 T C 6: 148,789,817 D685G probably benign Het
Klra10 T C 6: 130,275,856 T152A probably benign Het
Lmntd1 T A 6: 145,429,967 S82C probably damaging Het
Maip1 T C 1: 57,407,031 S87P possibly damaging Het
Mapkapk2 A G 1: 131,097,519 S3P unknown Het
Mei4 A G 9: 81,890,239 Y35C possibly damaging Het
Ms4a14 T G 19: 11,302,972 K741Q probably benign Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Ncapg2 A G 12: 116,419,268 I240V possibly damaging Het
Ncbp1 T A 4: 46,149,914 M145K probably damaging Het
Nmur2 A G 11: 56,032,940 F263L probably damaging Het
Ntrk2 A G 13: 58,846,762 E164G probably benign Het
Olfr48 T A 2: 89,844,272 T234S probably damaging Het
Olfr705 A G 7: 106,873,342 L301S possibly damaging Het
Olfr785 A T 10: 129,409,885 D173V probably benign Het
P3h2 T A 16: 25,985,065 Y317F probably damaging Het
Pcmtd1 C T 1: 7,120,420 R38C probably damaging Het
Pcyox1 T C 6: 86,391,679 T286A possibly damaging Het
Pdxk T C 10: 78,447,967 D131G probably benign Het
Ppl T C 16: 5,089,068 D1121G probably damaging Het
Ptgs1 C A 2: 36,245,210 N395K probably benign Het
Ptprq A T 10: 107,590,959 Y1572N probably damaging Het
Pyroxd1 A T 6: 142,358,501 H326L probably benign Het
Rapgef5 A G 12: 117,755,969 D778G probably benign Het
Rbm46 T A 3: 82,864,210 E366V probably damaging Het
Rnd1 G T 15: 98,670,669 H209Q probably benign Het
Rnf122 A T 8: 31,118,500 D32V possibly damaging Het
Samd4b G A 7: 28,406,456 P446S probably benign Het
Slco1a5 C A 6: 142,259,008 A187S possibly damaging Het
Smarca4 G A 9: 21,686,247 V1436M probably damaging Het
Smok2a G A 17: 13,226,639 G368R possibly damaging Het
Smok3c T A 5: 138,064,495 H81Q probably damaging Het
Soga3 T C 10: 29,197,003 S764P possibly damaging Het
Stk16 T C 1: 75,213,652 V245A probably damaging Het
Svep1 A T 4: 58,094,122 N1505K possibly damaging Het
Tigd4 G A 3: 84,595,164 A463T probably benign Het
Tmem117 T C 15: 94,714,918 F112L probably benign Het
Tmem72 A G 6: 116,698,330 I67T probably benign Het
Tnik A G 3: 28,663,909 probably null Het
Trav14-2 A G 14: 53,641,058 Q66R probably damaging Het
Trpv6 T A 6: 41,621,342 D677V probably damaging Het
Vgll4 C T 6: 114,862,196 S278N unknown Het
Wdfy4 C T 14: 33,070,618 W2157* probably null Het
Other mutations in Prkra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01459:Prkra APN 2 76630436 missense probably damaging 1.00
IGL02016:Prkra APN 2 76643309 splice site probably null
IGL02823:Prkra APN 2 76630424 missense probably damaging 1.00
IGL02962:Prkra APN 2 76633547 missense probably damaging 1.00
IGL03265:Prkra APN 2 76640270 missense probably benign 0.06
smallear UTSW 2 76630535 missense probably damaging 1.00
R1520:Prkra UTSW 2 76639278 missense possibly damaging 0.62
R1609:Prkra UTSW 2 76633592 missense probably benign 0.06
R1751:Prkra UTSW 2 76647240 missense possibly damaging 0.63
R1767:Prkra UTSW 2 76647240 missense possibly damaging 0.63
R2131:Prkra UTSW 2 76647136 missense probably damaging 1.00
R5288:Prkra UTSW 2 76639278 missense probably damaging 0.99
R5385:Prkra UTSW 2 76639278 missense probably damaging 0.99
R5386:Prkra UTSW 2 76639278 missense probably damaging 0.99
R6802:Prkra UTSW 2 76633537 missense probably damaging 1.00
R6918:Prkra UTSW 2 76630453 missense probably damaging 1.00
R7471:Prkra UTSW 2 76647201 missense probably benign 0.01
R8181:Prkra UTSW 2 76639290 missense probably damaging 1.00
R8290:Prkra UTSW 2 76633638 missense probably damaging 0.98
R8749:Prkra UTSW 2 76630535 missense probably damaging 1.00
R9035:Prkra UTSW 2 76630512 missense probably benign 0.00
R9101:Prkra UTSW 2 76647840 missense probably benign 0.04
R9115:Prkra UTSW 2 76647849 missense probably benign
R9290:Prkra UTSW 2 76647803 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCAGGCTAGCTCTTCACATC -3'
(R):5'- TACTGATGTTGGAACTGGCCC -3'

Sequencing Primer
(F):5'- CACATCTCACTAAGGTTTGAATAGGG -3'
(R):5'- TGGAACTGGCCCATTTCG -3'
Posted On 2019-10-07